ID: 1180230788

View in Genome Browser
Species Human (GRCh38)
Location 21:46425727-46425749
Sequence CGCCCTTCACAGAGTCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180230782_1180230788 -6 Left 1180230782 21:46425710-46425732 CCCTCTCCACAGCTGCCCGCCCT 0: 1
1: 0
2: 1
3: 41
4: 496
Right 1180230788 21:46425727-46425749 CGCCCTTCACAGAGTCCTGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1180230776_1180230788 23 Left 1180230776 21:46425681-46425703 CCGCCTGTACGAAGCCGAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1180230788 21:46425727-46425749 CGCCCTTCACAGAGTCCTGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1180230783_1180230788 -7 Left 1180230783 21:46425711-46425733 CCTCTCCACAGCTGCCCGCCCTT 0: 1
1: 0
2: 1
3: 40
4: 329
Right 1180230788 21:46425727-46425749 CGCCCTTCACAGAGTCCTGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1180230781_1180230788 -3 Left 1180230781 21:46425707-46425729 CCTCCCTCTCCACAGCTGCCCGC 0: 1
1: 0
2: 10
3: 79
4: 924
Right 1180230788 21:46425727-46425749 CGCCCTTCACAGAGTCCTGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1180230780_1180230788 -2 Left 1180230780 21:46425706-46425728 CCCTCCCTCTCCACAGCTGCCCG 0: 1
1: 0
2: 2
3: 57
4: 562
Right 1180230788 21:46425727-46425749 CGCCCTTCACAGAGTCCTGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1180230778_1180230788 20 Left 1180230778 21:46425684-46425706 CCTGTACGAAGCCGAGGCGGTGC 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1180230788 21:46425727-46425749 CGCCCTTCACAGAGTCCTGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135
1180230779_1180230788 9 Left 1180230779 21:46425695-46425717 CCGAGGCGGTGCCCTCCCTCTCC 0: 1
1: 0
2: 1
3: 27
4: 313
Right 1180230788 21:46425727-46425749 CGCCCTTCACAGAGTCCTGGCGG 0: 1
1: 0
2: 1
3: 15
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180230788 Original CRISPR CGCCCTTCACAGAGTCCTGG CGG Intronic
901210743 1:7524766-7524788 TGCCCCTCACAGGATCCTGGAGG + Intronic
904504032 1:30936103-30936125 CACCCTTCCCAGAGTCCCTGAGG - Intronic
904505496 1:30949532-30949554 CACCCTTCCCAGAGTCCCTGAGG - Intronic
908807849 1:67949286-67949308 TGAGCCTCACAGAGTCCTGGAGG + Intergenic
917329729 1:173868613-173868635 CGCCCTTCCCGGGGTCCTGAGGG - Intronic
917865499 1:179190578-179190600 CCCCCTCCACAGAGACGTGGGGG + Intronic
918143493 1:181736982-181737004 CTCCCTTCCCAGAGCCCTGCTGG - Intronic
918342208 1:183577321-183577343 CTCCCTTCAGAGAGCCCGGGGGG + Intronic
919822629 1:201482573-201482595 TGCCTTTCTCAGAGTCCAGGAGG + Intergenic
920847085 1:209603308-209603330 CTTCCTTCACAGAGGCCTGGTGG + Intronic
1063149387 10:3322689-3322711 GGCTCTCCACAGAGTCCTGAGGG - Intergenic
1063365656 10:5488740-5488762 CCCCCTGCACTGAGCCCTGGTGG - Intergenic
1063384871 10:5609868-5609890 AGCCCCCCACTGAGTCCTGGAGG - Intergenic
1064028774 10:11869898-11869920 CGCCCTGGACAGGGTCCTGCGGG - Exonic
1064310515 10:14208345-14208367 AGCCCTCCCCAGAGACCTGGGGG - Intronic
1067060661 10:43076593-43076615 CGCCCTTCTCTGAGTCCGCGGGG + Intergenic
1074040563 10:109784259-109784281 TACCCTTCACAAAGTCTTGGGGG + Intergenic
1074376553 10:112945738-112945760 GTCCCTTCACAGAGTCTTTGGGG + Intergenic
1076512555 10:131022816-131022838 CACCCTTCCCTGAGTCCCGGAGG - Intergenic
1078132455 11:8624103-8624125 CCCCATGCAAAGAGTCCTGGGGG - Intronic
1083544340 11:63537823-63537845 GGCCCTTCACTGGGTCCTGGAGG + Intronic
1089127005 11:116183564-116183586 GGCCCTACACAGAACCCTGGGGG + Intergenic
1089462206 11:118659890-118659912 CGCCCTGAACACAGTCCTGTGGG - Exonic
1089466736 11:118690525-118690547 CGCCCTGAACACAGTCCTGTGGG - Intergenic
1089655502 11:119944118-119944140 TGTCCTTCAGAGAGCCCTGGAGG + Intergenic
1089758712 11:120707136-120707158 GGCCATTTACAGAGGCCTGGAGG + Intronic
1089853154 11:121517655-121517677 GGCCCTTTACAGAGTCATGAAGG + Intronic
1090856038 11:130609941-130609963 CTCCCTGGACAGAGTCCTCGGGG - Intergenic
1091202636 11:133793839-133793861 TGCCTTTCTCTGAGTCCTGGGGG - Intergenic
1091390113 12:121046-121068 GGCCCTTCCCAGAGCACTGGAGG - Intronic
1100581412 12:95943330-95943352 CGTCCTCCACTGAGTCCTGCCGG + Exonic
1101583081 12:106061240-106061262 GGCCCATCACAGAGTCTGGGTGG - Intergenic
1102107542 12:110338344-110338366 CATCTTTCACAGAGTTCTGGTGG + Intronic
1102580279 12:113882046-113882068 GGCAAGTCACAGAGTCCTGGTGG + Intronic
1104546990 12:129721734-129721756 CCCTCTGAACAGAGTCCTGGGGG + Intronic
1112501542 13:99946927-99946949 AGCCCAGCAGAGAGTCCTGGAGG - Intergenic
1113933652 13:113981848-113981870 CGCCCTCCACAGAGGCCTGTGGG - Exonic
1114566776 14:23639032-23639054 GGCCCCTCACAGGGTCCTTGTGG + Intronic
1122018653 14:98818673-98818695 AGCCCTTCACTGAGGGCTGGCGG - Intergenic
1122383845 14:101330693-101330715 CTCCCGTCTCAGAGTCCTGGTGG - Intergenic
1122884747 14:104706023-104706045 CCTCCTGCACAGAGACCTGGAGG + Exonic
1124093081 15:26624410-26624432 CGCCCTTCTCAGAGTCCCTCCGG + Intronic
1124367020 15:29079324-29079346 CTCCCATCAGAGAGTCCAGGAGG + Intronic
1125578626 15:40770855-40770877 GGCCCTTCTCTGAGTGCTGGTGG - Exonic
1126574300 15:50182436-50182458 CGCCATCTACACAGTCCTGGCGG + Exonic
1130569394 15:85027131-85027153 AGGCCTTCAGGGAGTCCTGGAGG - Intronic
1132225099 15:100134202-100134224 CGCCTCTCAGAGGGTCCTGGGGG + Intronic
1136278526 16:29193337-29193359 CCATCTTCTCAGAGTCCTGGGGG + Intergenic
1141840221 16:86568996-86569018 CGCTCTTCACAGACGGCTGGGGG - Exonic
1142082917 16:88159415-88159437 CCATCTTCTCAGAGTCCTGGGGG + Intergenic
1142888727 17:2929388-2929410 CGCCCATCACAGTCACCTGGCGG - Intronic
1144819984 17:18065704-18065726 CTCCCTGCACAGAGCTCTGGGGG - Exonic
1145784747 17:27586571-27586593 GGCCCTTCACAGAACCTTGGAGG + Intronic
1147455405 17:40534896-40534918 GGTCCTACACAGAGTCCGGGGGG - Intergenic
1148731616 17:49840145-49840167 CTCCCTTCACAAACGCCTGGTGG + Intronic
1152141278 17:78538281-78538303 CCCCGTTTACAGAGTTCTGGAGG + Intronic
1152759828 17:82102003-82102025 TGGCCTTCACGGACTCCTGGAGG - Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160689659 19:455739-455761 CGCCTTTCCCAGCGTCCTGAGGG + Intronic
1161408001 19:4101193-4101215 CGCCCTCCCCAGAGCCCCGGGGG - Intronic
1162064896 19:8119346-8119368 CTCCCTGCCCTGAGTCCTGGCGG - Intronic
1162453664 19:10769544-10769566 CTCCCTTCAAAGAGTGCAGGGGG - Intronic
1164593971 19:29521537-29521559 CGCTGTGCACAGAGACCTGGAGG - Intergenic
1166723098 19:45008883-45008905 AGCCCTTCACAGAATCGTGGAGG - Intronic
1167079703 19:47270718-47270740 CGCCCTGCGGAGAGCCCTGGGGG - Intronic
1167581387 19:50345120-50345142 GGCCCTTCACAGACACCTGCTGG - Intronic
1167584503 19:50365996-50366018 GGCCCTTCACAGATACCTGCTGG - Intronic
1168016876 19:53581225-53581247 CACCTCTGACAGAGTCCTGGGGG + Intergenic
925025343 2:602652-602674 CGCCCTGCACAGACGCCTTGTGG - Intergenic
925251874 2:2445578-2445600 TGCCTTTCACAGAGTGCTGCTGG - Intergenic
925681667 2:6428756-6428778 AGGCCTTCTCAGAATCCTGGGGG + Intergenic
925874473 2:8300290-8300312 TGCCCCTCACACAGACCTGGTGG - Intergenic
925925219 2:8665283-8665305 CGCTCTTCACGCAGGCCTGGTGG - Intergenic
927095445 2:19744684-19744706 CGGCCTTCACTGAGTCCTGAGGG + Intergenic
927864521 2:26580140-26580162 CGCCCTCCACAGACTCCTTCAGG - Intergenic
931232062 2:60383285-60383307 GGCCCTCCACAGGGTCCTGCAGG + Intergenic
937451003 2:122001937-122001959 CTCCTTTCACAAAGTCCTGGAGG + Intergenic
940167574 2:150792594-150792616 GGCCCATCAGAGAGTCATGGTGG + Intergenic
941843133 2:170108982-170109004 GGCCCATGACAGTGTCCTGGAGG + Intergenic
944465567 2:199996572-199996594 ATACCTTCACAGTGTCCTGGAGG - Intronic
1168831631 20:848304-848326 CTCCCTCCACAGAGGCCTGCAGG - Intronic
1168948488 20:1780716-1780738 CGCCCATCACTGAGTCCTGTGGG - Intergenic
1169130875 20:3165913-3165935 CGCCCTCCCCAGAGCCCAGGTGG + Exonic
1170627462 20:18040658-18040680 AGTTCTTCACAGAGTCCTGGGGG - Intronic
1172426511 20:34859751-34859773 CGCACTTAACAGGCTCCTGGGGG - Intronic
1173219606 20:41121205-41121227 CCGCCTTCCCAGAGTACTGGTGG + Intronic
1174524369 20:51159465-51159487 CGCCCTTCACAGATGGCTGTGGG + Intergenic
1175231006 20:57473258-57473280 AGTCCTTCACAGAGTGGTGGGGG - Intergenic
1175643871 20:60654613-60654635 CCCACTCCACATAGTCCTGGTGG - Intergenic
1176184105 20:63768782-63768804 CGAGCCTCACAGAGCCCTGGTGG - Intronic
1176410638 21:6447851-6447873 CCCCCTGCACACAGGCCTGGTGG + Intergenic
1179686132 21:43056173-43056195 CCCCCTGCACACAGGCCTGGTGG + Intronic
1179901990 21:44399183-44399205 TGCCCTTCCCTGTGTCCTGGTGG + Intronic
1179950803 21:44707918-44707940 CACCCTTCCCGGAGCCCTGGGGG + Intronic
1180230788 21:46425727-46425749 CGCCCTTCACAGAGTCCTGGCGG + Intronic
1181005128 22:20009687-20009709 CATCCTTCAGAGGGTCCTGGGGG + Intronic
1181308982 22:21933564-21933586 CGCGGTTCACAGGGTCCTGGTGG + Exonic
1184302327 22:43568950-43568972 CACCCTTCACAGGGCCCAGGTGG + Intronic
1184686353 22:46098147-46098169 TGCCCTGCCCAGAGTCCTCGAGG + Intronic
1185041051 22:48504594-48504616 AGAGCTTCACAGACTCCTGGGGG + Intronic
1185295254 22:50049881-50049903 CTCCCTTCTCAGAGTCCCTGTGG - Intronic
960854835 3:122092285-122092307 GGCCCTTCACAGGGTCTTGAGGG - Intronic
964801650 3:160565097-160565119 CGCCATTCCCCGAGGCCTGGAGG + Intronic
968448921 4:666051-666073 GTCCCCTCACAGCGTCCTGGTGG - Intronic
968833221 4:2944190-2944212 GGCCCTTCACCACGTCCTGGAGG + Exonic
969808290 4:9627712-9627734 CTACCTAGACAGAGTCCTGGGGG + Intergenic
971478028 4:27090354-27090376 CGCCCCTCACACATTCCAGGTGG - Intergenic
973619959 4:52716516-52716538 AGCACTCCACGGAGTCCTGGTGG + Intergenic
976988451 4:91331607-91331629 AGCCCTTGACAGAGTCAGGGAGG - Intronic
978345818 4:107768060-107768082 TGCCCTTCTCAGAGTCCTTAAGG + Intergenic
978429564 4:108619586-108619608 CGCCTTTCTCAGCTTCCTGGAGG + Intergenic
981061717 4:140432018-140432040 CCCCCCACACAGAGTCCTTGTGG + Intergenic
985835947 5:2272049-2272071 AGCCCTTCACACAGTCCCTGGGG - Intergenic
989319077 5:40114053-40114075 CACCCTTTACAGAGTCCCTGGGG - Intergenic
1003190280 6:3868416-3868438 CCAGCTTCACAGAGTCCTAGTGG + Intergenic
1005501114 6:26430014-26430036 TTCCCTTCACACTGTCCTGGAGG - Intergenic
1005505667 6:26467162-26467184 TTCCCTTCACACTGTCCTGGAGG - Intronic
1005849477 6:29810646-29810668 CAGCCTTCAGAGAGTCCTGGAGG - Intergenic
1005861323 6:29904611-29904633 CTGCCTTCAGAGAGTCCTGGAGG - Intergenic
1008636620 6:53417369-53417391 CCACCTTCACAGATTCCTGCAGG - Intergenic
1011802605 6:91034532-91034554 CCCCCTTCACAGGGCTCTGGGGG - Intergenic
1014826634 6:126054535-126054557 CGCTCTTCACACAGTGCTGACGG + Intergenic
1018984354 6:168625064-168625086 GGCGCTTCACAGTGTCCAGGGGG - Intronic
1019168579 6:170115671-170115693 CAGCCTTCACTGAGCCCTGGGGG + Intergenic
1019598374 7:1868992-1869014 TGCCTTTCACAGAGCCTTGGGGG - Intronic
1019693864 7:2433586-2433608 CGCCCTTCAACGAGCACTGGCGG + Exonic
1022501286 7:30883694-30883716 GGCCCTTCACAAAGCCCTTGGGG + Intronic
1025037782 7:55609062-55609084 CGTCATCCACAGAGTCTTGGAGG - Intergenic
1026909239 7:74083144-74083166 TGCCCTGCCCAGGGTCCTGGAGG - Intronic
1029453367 7:100655243-100655265 CCCCCTTCCCAGAAACCTGGTGG + Intronic
1032781227 7:135166696-135166718 AGCCCTTCCCAGAGGCCGGGGGG - Exonic
1032793354 7:135258582-135258604 CCCACTCCAAAGAGTCCTGGAGG - Intergenic
1036945419 8:13090332-13090354 GGCCATCCACACAGTCCTGGAGG + Exonic
1038707565 8:29909201-29909223 TGCCCTTCCTAGAGTGCTGGTGG - Intergenic
1041023090 8:53657806-53657828 CGCGCTTCAGAGAGTGCAGGCGG - Intergenic
1045454826 8:102367520-102367542 CCCTTTTCACACAGTCCTGGAGG + Intronic
1047486442 8:125335137-125335159 CTTCCTTCTCAGAGTCCTGTTGG - Intronic
1052517904 9:29507407-29507429 CACCCTCCACAGAATCCTGGAGG + Intergenic
1055783254 9:79843002-79843024 CGGCCTGCACAGAGCCCAGGAGG - Intergenic
1056279153 9:85022848-85022870 TGCCCTTCCCACAGTCCTGTGGG - Exonic
1057438190 9:95061999-95062021 TGCCCATCACAGGGTCCTGGAGG - Intronic
1060415359 9:123426021-123426043 GGCACTTCACAGAGTCCTGGAGG + Intronic
1060767602 9:126306761-126306783 AGCCTTGCACAGAGCCCTGGAGG - Intergenic
1061185445 9:129050177-129050199 TGCCCTTCACAGGGTCGAGGCGG - Intronic
1061217940 9:129232523-129232545 CACCCTACACAGAGTTCTGCTGG - Intergenic
1062110170 9:134777832-134777854 CTCCCTGCCCTGAGTCCTGGGGG - Intronic
1062469040 9:136694339-136694361 AGCCCTTCGCAGAGGCCTTGGGG - Intergenic
1186182848 X:6989945-6989967 CTGCCTTCCCTGAGTCCTGGAGG - Intergenic
1189397226 X:40633715-40633737 CCACCTTCACAGAGACCTGTGGG - Intronic
1190274594 X:48891779-48891801 TTCCCTTCCGAGAGTCCTGGAGG - Intergenic
1195368863 X:104153036-104153058 GGCCCTAAACAGACTCCTGGAGG - Intronic
1199673796 X:150167545-150167567 CGACCTTCACCAAATCCTGGGGG + Intergenic