ID: 1180233750

View in Genome Browser
Species Human (GRCh38)
Location 21:46443930-46443952
Sequence TGACCTTCCCCCACTGTGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180233750_1180233756 11 Left 1180233750 21:46443930-46443952 CCCCACACAGTGGGGGAAGGTCA 0: 1
1: 0
2: 0
3: 22
4: 191
Right 1180233756 21:46443964-46443986 TCAGGCCCCGTCTCCTGCCAGGG 0: 1
1: 0
2: 2
3: 17
4: 222
1180233750_1180233755 10 Left 1180233750 21:46443930-46443952 CCCCACACAGTGGGGGAAGGTCA 0: 1
1: 0
2: 0
3: 22
4: 191
Right 1180233755 21:46443963-46443985 TTCAGGCCCCGTCTCCTGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 271
1180233750_1180233753 -7 Left 1180233750 21:46443930-46443952 CCCCACACAGTGGGGGAAGGTCA 0: 1
1: 0
2: 0
3: 22
4: 191
Right 1180233753 21:46443946-46443968 AAGGTCAGTGTGATGCCTTCAGG 0: 1
1: 0
2: 2
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180233750 Original CRISPR TGACCTTCCCCCACTGTGTG GGG (reversed) Exonic
900385210 1:2407456-2407478 TGACCTGCCACCTCTGTATGTGG - Intronic
900559419 1:3296388-3296410 TCTCCTTCCTCCACTCTGTGCGG + Intronic
902343190 1:15797997-15798019 TGACCTTCACCCAGTGTGAGTGG + Intergenic
903788074 1:25874795-25874817 TCCCCTTCCCTCACTGTGTGTGG + Intergenic
905535423 1:38717811-38717833 TGACCATTCCTCACTGAGTGGGG - Intergenic
906011704 1:42533092-42533114 TGCCCTTTCCCCACTGGGTGGGG + Intronic
907606004 1:55818138-55818160 TTACCTATCCCCATTGTGTGGGG + Intergenic
907952264 1:59195121-59195143 TGAACTTTCCCCACTATGGGAGG - Intergenic
913496531 1:119433043-119433065 TCACCTTACCCCACTGCCTGGGG - Intergenic
913512418 1:119573833-119573855 TCACCTTACCCCACTGCCTGGGG - Intergenic
915941884 1:160123473-160123495 TGCCCACCCCCCACTGTGTTGGG - Intronic
920276331 1:204807604-204807626 AGACCTTCCTCCACTTGGTGGGG + Intergenic
922792720 1:228318954-228318976 TGACCTGCACCTACTGTGGGAGG + Exonic
923022038 1:230172441-230172463 TGACCCTCAGACACTGTGTGAGG + Intronic
923045501 1:230352793-230352815 TCCCATTCTCCCACTGTGTGGGG - Intronic
924278194 1:242409602-242409624 TGTCCTTCCCTCTCTGTATGGGG - Intronic
924376568 1:243415549-243415571 TGACCCTCCCCCACTTTAGGGGG - Intronic
1063982817 10:11469719-11469741 TGCCCATCCCCCACTGTGCGGGG - Intronic
1067836770 10:49646344-49646366 CCACCTTGCCCCACTGTGGGTGG - Intronic
1071466702 10:85947151-85947173 TGCACTTCCCCTTCTGTGTGGGG - Intronic
1077929855 11:6719889-6719911 TGAGCTTCCTCCACTGTTTCTGG + Intergenic
1078508261 11:11967628-11967650 TTACCTTACCCGACTGTCTGTGG - Intronic
1079648897 11:22901783-22901805 TGACATTCCTCCTCTGTTTGAGG + Intergenic
1083154916 11:60816595-60816617 TGCCGTTTGCCCACTGTGTGTGG + Intergenic
1083859487 11:65412250-65412272 TGACCTCCCCTCCCTGTGTCTGG + Exonic
1084297420 11:68221998-68222020 TGCCCGTCCCCCCCAGTGTGGGG + Intergenic
1085349398 11:75788851-75788873 TGAATTTCCCACACTGGGTGGGG - Intronic
1089299243 11:117488556-117488578 TGACACTGCCCCTCTGTGTGTGG - Intronic
1090986967 11:131776357-131776379 TGCTCTTCCCTCACTGTGTTTGG - Intronic
1091026000 11:132141858-132141880 CGGCCTTCCCCTCCTGTGTGTGG - Intronic
1091126965 11:133109137-133109159 TTACCTGCTCCCACTGTGTCTGG + Intronic
1091537874 12:1430304-1430326 AGACCATCCCACACTGAGTGGGG + Intronic
1091638084 12:2213385-2213407 TGACCTTCCCCTTCTGTGCAGGG + Intronic
1091711278 12:2742281-2742303 GGAAATGCCCCCACTGTGTGGGG - Intergenic
1094117436 12:26932349-26932371 TTGCCTTTCCCCACTGTGTTTGG - Intronic
1095389865 12:41692867-41692889 TGATCTTACCCAACTGAGTGGGG + Intergenic
1098247688 12:68537332-68537354 TCTCCATCCCCCACTGTCTGTGG - Intergenic
1100750724 12:97695856-97695878 AGAACTTCCCCAACTGAGTGAGG - Intergenic
1101270331 12:103136765-103136787 TGTCCTTTCCCCAATGTATGAGG - Intergenic
1101579869 12:106032980-106033002 GGAGCTTCCCTGACTGTGTGAGG - Intergenic
1102195401 12:111021783-111021805 TGACCTTCCCACTGTGGGTGAGG - Intergenic
1103560366 12:121790294-121790316 GCCCCTTCCGCCACTGTGTGTGG + Intronic
1104417183 12:128605411-128605433 TGACATTCACCCACATTGTGGGG + Intronic
1104959596 12:132482209-132482231 TGACCTGCCCTCAGTGTGGGTGG - Intergenic
1106589893 13:31090073-31090095 TTACCTTTTCCCACTGAGTGAGG + Intergenic
1107132576 13:36911996-36912018 TGAGCTTCCCCGACTGGGTGCGG - Intronic
1107946352 13:45420406-45420428 TGACTTTCCCCCACAGGCTGGGG - Intergenic
1110584023 13:77166531-77166553 TGACATTCCCAGAATGTGTGAGG - Exonic
1112501899 13:99949518-99949540 TGCCCTTCCTCCCCTGGGTGTGG - Intergenic
1115019048 14:28652733-28652755 TGACCTTTCCCCATTTTGTAAGG + Intergenic
1117833335 14:59776656-59776678 TAGCCTTCCTCCGCTGTGTGGGG + Intronic
1119286339 14:73458169-73458191 TGACCGGCGGCCACTGTGTGAGG - Intronic
1121244073 14:92450075-92450097 TGACCTCCACCCACAGTGTTGGG + Intronic
1122684790 14:103496785-103496807 TCACCTTCCCCCAAAGTGTCAGG - Intronic
1124212332 15:27774205-27774227 TCACCTCACCCCACTGTGGGGGG + Intronic
1124376165 15:29130135-29130157 TGAGCTGCCCCCACAGCGTGGGG + Intronic
1124584642 15:30993244-30993266 TACCCTCCCCGCACTGTGTGAGG - Intergenic
1126911311 15:53419805-53419827 GGCCCTTACCCCACAGTGTGAGG - Intergenic
1127574925 15:60282256-60282278 ACATCTTCCTCCACTGTGTGAGG + Intergenic
1128238040 15:66080792-66080814 TGACTGTGCCCCAGTGTGTGGGG + Intronic
1130953783 15:88612506-88612528 GGACCATCCCCCACTGTGGCAGG + Intergenic
1132107092 15:99070957-99070979 AGACCTCTCCCCATTGTGTGAGG + Intergenic
1132882248 16:2167607-2167629 TCAGCTTCCCCCTCTGTGAGTGG + Intronic
1133682109 16:8129398-8129420 TGACCTTTCCCCATTGGCTGGGG + Intergenic
1134541860 16:15073580-15073602 TGACCTTGCCACAGTGTGTGAGG - Intronic
1135673404 16:24393754-24393776 TGACCTTACACAACTGTGGGAGG - Intergenic
1137546739 16:49410044-49410066 TACCCTTCGTCCACTGTGTGTGG - Intergenic
1138446140 16:57065362-57065384 TGACCTTCCCTCATCCTGTGGGG + Intronic
1139461717 16:67127899-67127921 TTACCTTCCCCCAGTGTTTCTGG - Intronic
1141147890 16:81544502-81544524 TGACCTTCCCGGCCTCTGTGTGG + Intronic
1142244475 16:88963217-88963239 TGGCCTTCCCCCACTGTCCCTGG - Intronic
1149784516 17:59423802-59423824 TGTCCTTTCTCCACAGTGTGAGG - Intergenic
1151353503 17:73545306-73545328 TGACCCACCCCTACTGTATGTGG + Intronic
1151380055 17:73719664-73719686 TGACCTTCCCACCCTGGGCGTGG + Intergenic
1152338367 17:79710307-79710329 TGGCATTCACCCACTGTCTGGGG + Intergenic
1152390833 17:80002795-80002817 TGCCTGTGCCCCACTGTGTGTGG - Intronic
1152431027 17:80248410-80248432 TGGTGTTCTCCCACTGTGTGGGG + Intronic
1152596947 17:81242425-81242447 TGTCCTTCACCCTGTGTGTGAGG + Intergenic
1155533543 18:26792150-26792172 ATACCTTCCTCCATTGTGTGGGG + Intergenic
1157351760 18:46894301-46894323 GGCCCTTCCCCCACAGTGAGTGG + Intronic
1159347105 18:67220369-67220391 TGACTTGACCCCACTATGTGAGG + Intergenic
1159858307 18:73615665-73615687 TGAACTACTTCCACTGTGTGGGG - Intergenic
1159974458 18:74692864-74692886 TGCCCTTCTCCTGCTGTGTGAGG + Intronic
1160342789 18:78103932-78103954 TGACTTTCCCTCACTGTGTCTGG + Intergenic
1163267006 19:16227581-16227603 TGAAGTTCCACCAGTGTGTGCGG + Exonic
1164632007 19:29768190-29768212 TGAGCCTCCCCCACCCTGTGGGG + Intergenic
1164955302 19:32377857-32377879 TGACCTTCCTCCCCTGGCTGAGG - Intronic
1165766210 19:38352727-38352749 AGTCCTTCTGCCACTGTGTGTGG - Intronic
1166165076 19:40981838-40981860 TGTCCTTCCCACAACGTGTGGGG + Intergenic
1166718921 19:44986529-44986551 TGCCCTTCACCCACGGCGTGTGG - Exonic
1167050564 19:47075389-47075411 GGCCCTTCCTCAACTGTGTGTGG + Intronic
1167404562 19:49296275-49296297 TTACCTTCCCAGACTGAGTGTGG - Intronic
1167621578 19:50563760-50563782 TGACTTTCCAACACTGTGAGGGG + Intronic
1168279251 19:55295486-55295508 TGGAGTTCCCCCACTCTGTGGGG + Intronic
925665807 2:6254498-6254520 TCAGTTTCCTCCACTGTGTGGGG - Intergenic
925837451 2:7959982-7960004 TGACCATCCAGCAATGTGTGAGG + Intergenic
926140960 2:10367819-10367841 TGAACACCCCACACTGTGTGGGG - Intronic
927216009 2:20668086-20668108 TGGGCTTCCCCCAATTTGTGTGG - Intronic
929160529 2:38827787-38827809 CCACCTTCCCCCACTATCTGGGG + Intronic
930416554 2:51097006-51097028 TCACCTTGTCCCACAGTGTGTGG + Intergenic
932407879 2:71525991-71526013 TGACCTTCCAGGACTGTGCGAGG - Intronic
933329236 2:80876083-80876105 TGACATTCCACCACTGTGATTGG - Intergenic
935333311 2:101993417-101993439 TGACCTTCTTCCCCTGTGTGAGG - Intronic
936346750 2:111681303-111681325 TGACCATCCCCTACTGTATGAGG - Intergenic
936813872 2:116435541-116435563 TGTCCCTCCCACAATGTGTGTGG - Intergenic
937541912 2:122966137-122966159 TAACCTTCCCCCACTGCTTCAGG + Intergenic
940848260 2:158663753-158663775 TGACCTTCCCTTACACTGTGTGG - Intronic
941056696 2:160797450-160797472 TGTCCTGCGCCCACTGTCTGAGG - Intergenic
941420954 2:165282258-165282280 TGACCTTCCACCAGTTTGGGTGG + Intronic
943424332 2:187711105-187711127 TGGAATTCCCCCACTGTTTGTGG - Intergenic
944506433 2:200417193-200417215 TGATCTTCCCCCACTGGGAAGGG - Intronic
944625508 2:201564678-201564700 TGATCTCCCTCCACAGTGTGAGG + Intronic
945700708 2:213167849-213167871 TGATCTGCACCCACTGTGTGTGG + Intergenic
946204310 2:218092410-218092432 GGACCTTCTCCCACTGTTTGGGG + Intergenic
948389455 2:237601609-237601631 TCACCTTCCCCGACTGACTGAGG + Intronic
948443134 2:238010627-238010649 TGAGGTTCCCCCACTTTGAGGGG - Intronic
1171784239 20:29448374-29448396 TGACAGCCCTCCACTGTGTGGGG + Intergenic
1171964102 20:31516351-31516373 TGAACTTCCACCACTGTCAGGGG + Intronic
1172132439 20:32664662-32664684 TGGCAGTCCCCCACAGTGTGGGG + Intergenic
1173507424 20:43599019-43599041 TGACCTTCCCCCGCTGGGAATGG + Intronic
1174175217 20:48640312-48640334 TCACTTTCCCACTCTGTGTGTGG - Intronic
1174521046 20:51131080-51131102 TGACCTCCCACCAGTGTTTGCGG + Intergenic
1175591307 20:60194063-60194085 TGCCCCTCTCCCACTGTGTATGG - Intergenic
1176430764 21:6574109-6574131 CGAGCTTGCCCCTCTGTGTGTGG + Intergenic
1176688360 21:9875088-9875110 TGTCCTTCCCCCAACATGTGGGG + Intergenic
1179008750 21:37536946-37536968 TGTCCTTCCCCCATTGGCTGGGG + Intergenic
1179674610 21:42973525-42973547 TGCCCTTCCCGCGCTGTGTATGG + Intergenic
1179706158 21:43181571-43181593 CGAGCTTGCCCCTCTGTGTGTGG + Intergenic
1180233750 21:46443930-46443952 TGACCTTCCCCCACTGTGTGGGG - Exonic
1181854068 22:25769654-25769676 GGACCTTCCCTCACTCTGTGGGG - Intronic
1183456671 22:37926719-37926741 TGCTCTTGCCCCACTGTGAGAGG - Intronic
1183811320 22:40260077-40260099 CGACATTCCCACGCTGTGTGCGG + Intronic
1184782906 22:46658034-46658056 TGACCTTCCTCCAGGGTGCGGGG - Intronic
1184984378 22:48119430-48119452 CCACCTTCCTCCACTGTCTGGGG + Intergenic
1185284861 22:49995656-49995678 AGCCCTGCCCCCACTGTGCGAGG + Exonic
949490030 3:4580405-4580427 TGTCCTGCCCCCACTTTGAGAGG - Intronic
950199778 3:11034730-11034752 TGCCCTTCTCCCACTGTGTCAGG + Intronic
950418876 3:12885009-12885031 CGTCCTTCCCTCGCTGTGTGAGG - Intergenic
953052792 3:39361349-39361371 TGAGCTTCCCTCAATGTCTGTGG - Intergenic
954441377 3:50524099-50524121 TGACCTTCCCCAAATCTGGGTGG + Intergenic
956819713 3:72943074-72943096 TGATTTTCACCCACTGTGTCTGG - Intronic
957155398 3:76537969-76537991 TGACCTTCCACCACTATGACTGG - Intronic
958986177 3:100782102-100782124 TGAGCTGCCACCACTGTGTGAGG + Intronic
960463531 3:117967136-117967158 AGACCTACCCTCAATGTGTGTGG + Intergenic
968659492 4:1793249-1793271 GGACCGTCCCCCACTGGCTGCGG + Intergenic
972117216 4:35651415-35651437 TGACATGGCCCCACTGTGTAAGG + Intergenic
978719013 4:111883703-111883725 TGAGCCTCCCCCGCTGTGTCAGG + Intergenic
978759159 4:112336250-112336272 TCACCTATCTCCACTGTGTGTGG - Intronic
979366703 4:119833763-119833785 TGGCTTTCCCCTACTGTGAGTGG + Intergenic
979404736 4:120295638-120295660 AGTCCTTCACCTACTGTGTGAGG - Intergenic
980351735 4:131692888-131692910 TGTCCTTCCCCCAGCATGTGGGG + Intergenic
981168904 4:141598217-141598239 TGATTTTCTCCCACTCTGTGGGG - Intergenic
985621226 5:957243-957265 TGGGCTTCCCCCATTGTCTGGGG - Intergenic
993684736 5:90924450-90924472 TGTCCTTCGCCCACTTTTTGAGG + Intronic
993742737 5:91560693-91560715 TAACCTTTCCCCACTTTTTGAGG - Intergenic
995241603 5:109890992-109891014 TGACCTTCTCTCATTCTGTGAGG + Intergenic
997965072 5:138350395-138350417 TGACATTCTTCCAATGTGTGTGG + Intergenic
1001593379 5:172881648-172881670 TGCTTTTCCCCCACAGTGTGGGG - Intronic
1004384401 6:15159897-15159919 TGACCTTCCTCCACTGAGACAGG - Intergenic
1007394601 6:41570386-41570408 TGTCCTTCTCTCACTGTGTCAGG - Intronic
1008774933 6:55026915-55026937 TGACCTTAGCCCACTTTTTGAGG + Intergenic
1009633736 6:66235548-66235570 TGACCTTCTTGTACTGTGTGTGG - Intergenic
1010036524 6:71331556-71331578 TAACCTTCCCACACTTTATGTGG + Intergenic
1010131638 6:72500862-72500884 TCCCCTGCCCCCACTGTGAGTGG - Intergenic
1013978135 6:116100461-116100483 TGACCTTTTACCCCTGTGTGAGG - Intergenic
1016544370 6:145203866-145203888 TGACCATCCAGCACTCTGTGAGG - Intergenic
1018832165 6:167451466-167451488 TGATCTTCCCTCACCCTGTGAGG - Intergenic
1019433499 7:1010460-1010482 GGATCTTCCCACACTGTGTGGGG - Intronic
1020622309 7:10533338-10533360 TGTCCTGCCCCCACTGTCCGAGG - Intergenic
1021227960 7:18050792-18050814 TGACCTTCAGCCACTGTCTCTGG - Intergenic
1023026816 7:36058321-36058343 TGTCCCTCCCTCACTGTGGGAGG + Intergenic
1023072128 7:36446357-36446379 TGTTCTTTCCCCACTGTGTTAGG + Intronic
1026092758 7:67315113-67315135 TCACCTTCTCTCACTATGTGGGG + Intergenic
1026113463 7:67476813-67476835 TGAAGTTCCCACACTGTGCGAGG - Intergenic
1028829778 7:95314496-95314518 TGGACTTTCCCCACTGTGGGTGG - Intronic
1030866984 7:114711867-114711889 TCACCTTCCCCCGCTGGATGGGG - Intergenic
1031077403 7:117225985-117226007 TGACCTTCCCACATTCTGTGAGG - Intronic
1033207596 7:139436314-139436336 TGCCCTTCCCCCACTGTCTAGGG + Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1038217944 8:25579997-25580019 TGACCATCCTTGACTGTGTGTGG + Intergenic
1038981294 8:32762345-32762367 TGACATTTCCCCACTGTGCTGGG + Intronic
1045063394 8:98426716-98426738 TGACCTTTCCCCGCTGGGTCTGG - Intronic
1045193998 8:99911653-99911675 TGACCTTCCACCATGTTGTGAGG - Intergenic
1046888991 8:119400693-119400715 TCACATTCCTCCACTCTGTGTGG - Intergenic
1051596284 9:18827121-18827143 TGTTCTTCCCCCACTGAGTCTGG + Intronic
1053548918 9:39054650-39054672 TGGCCTTCCCTGAGTGTGTGGGG - Intergenic
1053780980 9:41606813-41606835 TGTCCTTCCCCCAACATGTGGGG - Intergenic
1053813036 9:41874718-41874740 TGGCCTTCCCTGAGTGTGTGGGG - Intergenic
1054168923 9:61816970-61816992 TGTCCTTCCCCCAACATGTGGGG - Intergenic
1054617559 9:67312721-67312743 TGGCCTTCCCTGAGTGTGTGGGG + Intergenic
1054668607 9:67763841-67763863 TGTCCTTCCCCCAACATGTGGGG + Intergenic
1054748837 9:68883886-68883908 TATCCTTTCCCCATTGTGTGTGG - Intronic
1056808302 9:89745236-89745258 TGGCCCTCCCCCACTGAGAGTGG - Intergenic
1059862795 9:118483758-118483780 TGACTTTACCCCACTGAGGGTGG + Intergenic
1060256463 9:122035196-122035218 TGACTTTCACCCAGTGTCTGGGG + Intronic
1060915791 9:127389565-127389587 AGACCTGCCCCCACTGTCTAGGG - Intronic
1061096233 9:128458148-128458170 TGATCTCCCCCCACTTTGGGGGG + Intronic
1062179194 9:135181566-135181588 TGACGCTCCTCCACTGTGTTGGG + Intergenic
1203444849 Un_GL000219v1:45255-45277 TGACGGCCCTCCACTGTGTGGGG + Intergenic
1185577027 X:1182578-1182600 TGACCTTCCCCCATTTTTTATGG + Intergenic
1186201464 X:7159220-7159242 TGATTTTCCCCCAAGGTGTGTGG + Intergenic
1187140779 X:16591710-16591732 TGACCTTCCCCCACTGAAGCAGG + Intronic
1190114997 X:47620381-47620403 TGACCTCACCCCCCTCTGTGAGG - Intergenic
1191216540 X:57937468-57937490 TGTCCTTCACCCACTTTTTGAGG + Intergenic
1192118265 X:68432071-68432093 TCTCCTTCCCCCATTGTGTGTGG - Intronic
1192291393 X:69799400-69799422 TTACCTTCTCCCATTCTGTGGGG - Intronic
1192317172 X:70062177-70062199 TGGCCTTCCTGCAATGTGTGTGG - Intergenic
1192634709 X:72806271-72806293 TGAACTTCCCCCACTGAGTTAGG + Intronic
1192647004 X:72914530-72914552 TGAACTTCCCCCACTGAGTTAGG - Intronic
1193020352 X:76785033-76785055 TGTCCTTCACCCACTTTTTGAGG - Intergenic
1194857250 X:98947854-98947876 TGACCTACCCCTAATATGTGTGG - Intergenic
1196920805 X:120583472-120583494 GGACCTTCCCCCAATATGTGGGG - Intergenic
1199932727 X:152540731-152540753 TGGCCTTCCCCCACACTCTGAGG + Intergenic
1200144798 X:153921024-153921046 TGTTCCTCCCCCACTGTGAGTGG + Intronic