ID: 1180234572

View in Genome Browser
Species Human (GRCh38)
Location 21:46450011-46450033
Sequence GCTTTTGAGGTGATTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180234572_1180234579 14 Left 1180234572 21:46450011-46450033 CCCACCACAATCACCTCAAAAGC No data
Right 1180234579 21:46450048-46450070 TTTAATGACTGCACCTGGGATGG No data
1180234572_1180234578 10 Left 1180234572 21:46450011-46450033 CCCACCACAATCACCTCAAAAGC No data
Right 1180234578 21:46450044-46450066 AACTTTTAATGACTGCACCTGGG No data
1180234572_1180234581 27 Left 1180234572 21:46450011-46450033 CCCACCACAATCACCTCAAAAGC No data
Right 1180234581 21:46450061-46450083 CCTGGGATGGATGCCTGATATGG No data
1180234572_1180234577 9 Left 1180234572 21:46450011-46450033 CCCACCACAATCACCTCAAAAGC No data
Right 1180234577 21:46450043-46450065 AAACTTTTAATGACTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180234572 Original CRISPR GCTTTTGAGGTGATTGTGGT GGG (reversed) Intergenic
No off target data available for this crispr