ID: 1180235863

View in Genome Browser
Species Human (GRCh38)
Location 21:46459076-46459098
Sequence AACCGGACCGGGCCTGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180235863_1180235868 -8 Left 1180235863 21:46459076-46459098 CCGCCGCCAGGCCCGGTCCGGTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1180235868 21:46459091-46459113 GTCCGGTTCCAGCCTCTGCCCGG 0: 1
1: 0
2: 1
3: 23
4: 189
1180235863_1180235879 25 Left 1180235863 21:46459076-46459098 CCGCCGCCAGGCCCGGTCCGGTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1180235879 21:46459124-46459146 GCCTGGCCATGGCTGACCGCGGG 0: 1
1: 0
2: 2
3: 18
4: 215
1180235863_1180235878 24 Left 1180235863 21:46459076-46459098 CCGCCGCCAGGCCCGGTCCGGTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1180235878 21:46459123-46459145 GGCCTGGCCATGGCTGACCGCGG 0: 1
1: 0
2: 7
3: 63
4: 333
1180235863_1180235876 14 Left 1180235863 21:46459076-46459098 CCGCCGCCAGGCCCGGTCCGGTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1180235876 21:46459113-46459135 GACGCTAGCCGGCCTGGCCATGG 0: 1
1: 0
2: 1
3: 7
4: 84
1180235863_1180235871 3 Left 1180235863 21:46459076-46459098 CCGCCGCCAGGCCCGGTCCGGTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1180235871 21:46459102-46459124 GCCTCTGCCCGGACGCTAGCCGG 0: 1
1: 0
2: 0
3: 12
4: 93
1180235863_1180235873 8 Left 1180235863 21:46459076-46459098 CCGCCGCCAGGCCCGGTCCGGTT 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1180235873 21:46459107-46459129 TGCCCGGACGCTAGCCGGCCTGG 0: 1
1: 0
2: 0
3: 1
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180235863 Original CRISPR AACCGGACCGGGCCTGGCGG CGG (reversed) Intronic