ID: 1180235932

View in Genome Browser
Species Human (GRCh38)
Location 21:46459299-46459321
Sequence CCCGCGCGGCCCCTCACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 2, 2: 3, 3: 24, 4: 260}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180235911_1180235932 28 Left 1180235911 21:46459248-46459270 CCGCGACCCGCCCTCAGCCCGGT 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235924_1180235932 -6 Left 1180235924 21:46459282-46459304 CCCCTCACTCCGGGACCCCCGCG 0: 1
1: 0
2: 1
3: 20
4: 145
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235917_1180235932 10 Left 1180235917 21:46459266-46459288 CCGGTCCCCCGCGCAGCCCCTCA 0: 1
1: 0
2: 1
3: 36
4: 345
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235909_1180235932 29 Left 1180235909 21:46459247-46459269 CCCGCGACCCGCCCTCAGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235915_1180235932 17 Left 1180235915 21:46459259-46459281 CCTCAGCCCGGTCCCCCGCGCAG 0: 1
1: 1
2: 6
3: 32
4: 342
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235919_1180235932 4 Left 1180235919 21:46459272-46459294 CCCCGCGCAGCCCCTCACTCCGG 0: 1
1: 0
2: 4
3: 21
4: 248
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235914_1180235932 18 Left 1180235914 21:46459258-46459280 CCCTCAGCCCGGTCCCCCGCGCA 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235912_1180235932 22 Left 1180235912 21:46459254-46459276 CCCGCCCTCAGCCCGGTCCCCCG 0: 1
1: 0
2: 7
3: 71
4: 535
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235908_1180235932 30 Left 1180235908 21:46459246-46459268 CCCCGCGACCCGCCCTCAGCCCG 0: 1
1: 0
2: 0
3: 30
4: 259
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235913_1180235932 21 Left 1180235913 21:46459255-46459277 CCGCCCTCAGCCCGGTCCCCCGC 0: 1
1: 1
2: 2
3: 65
4: 622
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235916_1180235932 11 Left 1180235916 21:46459265-46459287 CCCGGTCCCCCGCGCAGCCCCTC 0: 1
1: 0
2: 5
3: 53
4: 451
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235926_1180235932 -8 Left 1180235926 21:46459284-46459306 CCTCACTCCGGGACCCCCGCGCG 0: 1
1: 0
2: 0
3: 14
4: 121
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235921_1180235932 3 Left 1180235921 21:46459273-46459295 CCCGCGCAGCCCCTCACTCCGGG 0: 1
1: 0
2: 3
3: 25
4: 273
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235923_1180235932 2 Left 1180235923 21:46459274-46459296 CCGCGCAGCCCCTCACTCCGGGA 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235918_1180235932 5 Left 1180235918 21:46459271-46459293 CCCCCGCGCAGCCCCTCACTCCG 0: 1
1: 0
2: 2
3: 26
4: 270
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235925_1180235932 -7 Left 1180235925 21:46459283-46459305 CCCTCACTCCGGGACCCCCGCGC 0: 1
1: 0
2: 7
3: 17
4: 150
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180235932 Original CRISPR CCCGCGCGGCCCCTCACTCC AGG Intronic
900155881 1:1203116-1203138 CCCGCCCAGCCTCCCACTCCAGG - Intergenic
900572277 1:3364548-3364570 ACCGCTCAGCCCCTCACCCCCGG + Intronic
901012436 1:6209357-6209379 GCCGCGCGGCCCCGCGCGCCAGG - Intronic
901361319 1:8703264-8703286 CCCGCGCGGCCACCGCCTCCCGG - Intronic
902092706 1:13916132-13916154 CCCAAGAGGACCCTCACTCCTGG - Intergenic
902916713 1:19644172-19644194 CGCGCGCGGCCTCTCCCTCCGGG - Intronic
903536239 1:24068164-24068186 CCCGCCCTGCCCCGCACACCTGG - Intronic
903706706 1:25291079-25291101 CCAGCTCGGTCCCTAACTCCTGG - Intronic
903832339 1:26182763-26182785 CCCGCGTGGCCCCTCAGGACTGG - Intronic
904603160 1:31684539-31684561 CCCGCGGGGCCCTGAACTCCAGG + Exonic
904747449 1:32719892-32719914 CCCACCCGGCCCCTCAGGCCTGG - Intergenic
905448759 1:38044414-38044436 CCCGCGGGGCCCTGCCCTCCTGG - Exonic
905734355 1:40315633-40315655 CCCGGGGGGCCCCGCTCTCCCGG + Exonic
906533043 1:46534300-46534322 CTCACGTGGCCACTCACTCCAGG - Intergenic
907429972 1:54406076-54406098 CCCGAGCTGCCCCTCGCTCCCGG + Exonic
910669999 1:89763093-89763115 CCCCGGCCGCCGCTCACTCCAGG - Intronic
910771558 1:90836448-90836470 CCCGCAAGCCCCCCCACTCCAGG + Intergenic
914492383 1:148160484-148160506 CCCGCGCGCCCTCTCCCTACCGG - Intergenic
922866279 1:228863892-228863914 CCCGCACAGCCCCTCTCACCTGG - Intergenic
922894174 1:229088014-229088036 CCCACGCTTCCCCTGACTCCAGG + Intergenic
1064552891 10:16520838-16520860 CCCGCGCGGACCCGCCTTCCCGG + Exonic
1067078744 10:43202479-43202501 CCCGCGCGGCCTCTGCCCCCGGG + Intronic
1067982214 10:51099240-51099262 CCATCTCTGCCCCTCACTCCAGG - Intronic
1069018949 10:63465151-63465173 CCCGCGCGGCGCCGGACTCGCGG + Intronic
1073479792 10:103779316-103779338 CCCGCACGGCGCCTCATGCCAGG - Intronic
1074156883 10:110807458-110807480 CCCGCTCTGCCCCTCACTGGGGG + Intronic
1075635411 10:124027172-124027194 TCGGCGCGGCCCCTCACACTGGG + Intronic
1076526805 10:131117234-131117256 CCTGGGCAGGCCCTCACTCCAGG + Intronic
1076648530 10:131971138-131971160 CCCGGGCCGCGCCGCACTCCCGG + Intronic
1076916292 10:133424419-133424441 CCCGCGCCGCCCCTCGCTCCCGG + Intronic
1076936399 10:133569214-133569236 CCCGCGCCGCCCCTCGCTCCCGG + Intronic
1076945791 10:133648916-133648938 ACCGCTCTGCCCCTCCCTCCAGG + Intergenic
1077476140 11:2791526-2791548 CCCGAGCCTCCCCTCCCTCCCGG + Intronic
1079128472 11:17734700-17734722 CCAGCGCGGCGCCTTCCTCCGGG + Intergenic
1083945114 11:65919199-65919221 CCCCCGCGGCCCGCCCCTCCCGG - Intergenic
1084195079 11:67519986-67520008 CACGCGCAGCCCCTCACTCACGG + Intronic
1084910191 11:72381858-72381880 TCCCTGCGGCCCCACACTCCAGG + Intronic
1088706082 11:112465901-112465923 CCCTCGCTGTCCCCCACTCCAGG - Intergenic
1093894786 12:24563195-24563217 CCCGCGCGCGCCCTCCCTGCCGG - Intergenic
1096139936 12:49234550-49234572 CCCGCGTGGCGCCGCAGTCCTGG + Intronic
1100854370 12:98745929-98745951 CACGCGAGGCCCCTCGCCCCAGG + Intronic
1101150336 12:101877623-101877645 CTCGCGCTTCCCCTCCCTCCGGG + Exonic
1101493859 12:105235821-105235843 CCCTCGCGGCGCCTCCCACCGGG - Intronic
1104667300 12:130656578-130656600 CCCGGGCTCCCCCTGACTCCTGG + Intronic
1104838901 12:131810938-131810960 CCCGCTCGGGCTCTCAGTCCGGG - Intergenic
1104887833 12:132121495-132121517 CCTGCTCGGCTCCTCCCTCCTGG - Intronic
1104955234 12:132461597-132461619 TCCTGGCGGCCCCTCACTCAGGG - Intergenic
1104968839 12:132522087-132522109 CCGGCGCGGCCCCTCAGCCTGGG + Intronic
1105585491 13:21739115-21739137 CCCTTGCCGCCCCTCAGTCCAGG + Intergenic
1108220944 13:48233085-48233107 CCCGCGCAGCACCCCACCCCCGG + Intergenic
1109222441 13:59653867-59653889 CCCACCTGGCACCTCACTCCTGG + Intergenic
1112272077 13:97977054-97977076 CCCGCCCGGCACCCCACACCTGG - Intronic
1113939158 13:114009729-114009751 CCCGGGCTGTCCCTCACACCTGG + Intronic
1114037856 14:18646277-18646299 CCCGAGCTGCCCCTGGCTCCCGG + Intergenic
1114120765 14:19668751-19668773 CCCGAGCTGCCCCTGGCTCCCGG - Intergenic
1116430001 14:44835794-44835816 CCTCCCCAGCCCCTCACTCCTGG - Intergenic
1119385976 14:74258404-74258426 CCGGCGCCGCCCTTCCCTCCGGG - Intronic
1120521760 14:85533422-85533444 CCCGCGCAGCGCCGCACGCCCGG + Intronic
1122162183 14:99793009-99793031 CCCACGCGCCCGCTCTCTCCCGG + Intronic
1122855110 14:104556406-104556428 CCAGCCCTGCCCCTCACCCCAGG + Intronic
1122860885 14:104581923-104581945 AGCGTGCGGCCCCACACTCCCGG - Intronic
1122860901 14:104581983-104582005 AGCGTGCGGCCCCACACTCCCGG - Intronic
1202919898 14_KI270723v1_random:21509-21531 ACCGCTCTGCCCCTCCCTCCAGG + Intergenic
1202925022 14_KI270724v1_random:16129-16151 ACCGCTCTGCCCCTCCCTCCAGG - Intergenic
1123722253 15:23069688-23069710 CCCGCGGGGCCCACCACGCCCGG - Intergenic
1124322784 15:28727279-28727301 CCTGCGCGGCCCACCACACCCGG - Intronic
1124523702 15:30427844-30427866 CCTGCGCGGCCCACCACACCCGG - Intergenic
1124534965 15:30538371-30538393 CCTGCGCGGCCCACCACACCCGG + Intergenic
1124574404 15:30895525-30895547 CCCGCGGGGCCCACCACACCCGG + Intergenic
1124763684 15:32469230-32469252 CCTGCGCGGCCCACCACACCCGG - Intergenic
1125553370 15:40564774-40564796 CCCGCATGGCCCCTTACCCCAGG + Exonic
1125716379 15:41822123-41822145 CCCCCATGGCCCCTCCCTCCAGG - Intronic
1126823666 15:52528925-52528947 CCCGCGCGGCCCTCCCCGCCCGG - Exonic
1126852579 15:52806062-52806084 CCCGCGCGGCCTCTTACGCCGGG + Intergenic
1127083996 15:55408058-55408080 CCCGTGCGGCCGCTGACACCAGG + Intronic
1129199858 15:73992283-73992305 CCTACGCGGCCCCGCCCTCCTGG + Exonic
1129659040 15:77542904-77542926 CCCGCGGGGCTCCCCACCCCGGG + Intergenic
1129719793 15:77871857-77871879 GCCACGCGGCCCCTGACCCCAGG + Intergenic
1130348119 15:83067293-83067315 CGCGCGCGCCCCCGCACGCCCGG + Exonic
1132163618 15:99565288-99565310 CCCGCCCGGCCCCGGACTCCGGG + Intergenic
1132508573 16:325105-325127 CGCGGGCGGCCCCGCACCCCAGG + Intronic
1132508588 16:325146-325168 CGCGGGCGGCCCCGCACCCCAGG + Intronic
1132551160 16:554352-554374 CCCTCCTGGCCCCTCACTCCCGG + Exonic
1132559762 16:588227-588249 TCCCTGAGGCCCCTCACTCCAGG - Intergenic
1132709459 16:1259940-1259962 CCCGCCCTGCCTGTCACTCCCGG - Intergenic
1133345916 16:5070358-5070380 CCAGCGAGGCCCCTGCCTCCAGG - Intronic
1136779210 16:32886330-32886352 TCCGGGCCGCCCCTCACCCCAGG + Intergenic
1136891407 16:33975188-33975210 TCCGGGCCGCCCCTCACCCCAGG - Intergenic
1137400926 16:48153970-48153992 CCCAGGCAGCTCCTCACTCCTGG - Intronic
1139750400 16:69106339-69106361 CCCGCGCGGCCCTCCCCTCCTGG - Intronic
1140223002 16:73057927-73057949 CCCGCGCGGCTGCTCAGCCCGGG + Intronic
1141054914 16:80804956-80804978 GCTGCGCGGCCCCTCCCTCCAGG + Intergenic
1141452868 16:84117233-84117255 CCCGCGCGGACCCTTCCTGCAGG + Intergenic
1141830682 16:86508602-86508624 CGGGCGCGGCCTCTCCCTCCAGG - Intergenic
1141903481 16:87007661-87007683 CCAGCCCAGCACCTCACTCCTGG - Intergenic
1142118888 16:88376361-88376383 CCCGGACGTCCCCTCACACCGGG - Intergenic
1142292913 16:89201058-89201080 CCCGCCCGGCCCCTCTCCGCGGG + Intronic
1203081626 16_KI270728v1_random:1148418-1148440 TCCGGGCCGCCCCTCACCCCAGG + Intergenic
1143166364 17:4899161-4899183 CCCGCGCGGCCCCCCGGGCCAGG + Intronic
1143584431 17:7844217-7844239 CCCGAGTGGCCCCTCTCTCGTGG - Intronic
1143719438 17:8799334-8799356 CCCGCCCCGCCTCTCCCTCCGGG - Exonic
1146077430 17:29744193-29744215 CCCACCTGGCCCCTCACCCCCGG - Intronic
1147896593 17:43755516-43755538 CGCGCGCGGCGCCTCACCACCGG + Exonic
1147989735 17:44325338-44325360 CCGGCGCGGCGGCTCACGCCTGG - Intergenic
1147994535 17:44353682-44353704 CCCGCGCGGGCCCGCACCCAGGG - Exonic
1148028019 17:44601652-44601674 CCCCCGCGCCCCCTGACTTCAGG - Intergenic
1149454971 17:56780421-56780443 CCCGCGCCCGCCCTCGCTCCGGG + Intergenic
1149597865 17:57874765-57874787 CCCGCCCGCCCCCTCACTGGAGG + Intronic
1149626337 17:58083304-58083326 CCCGCCCGGCCCCGCACTGCGGG - Intergenic
1149626492 17:58083857-58083879 CCCCCGCCGCCCCTCCCTCTCGG + Intronic
1151801974 17:76384219-76384241 CGCGCGCGGCTCCGCTCTCCCGG - Intronic
1152069731 17:78128622-78128644 CGCGCGCGGCCCCTCCTCCCCGG - Exonic
1152573836 17:81131700-81131722 CCCGAGCAGCCCCTCACCCCGGG + Intronic
1152629463 17:81403810-81403832 TCCACGCGGCCCCACATTCCCGG - Intronic
1152636743 17:81433285-81433307 CACACACGGCCCCTCACCCCAGG - Intronic
1152938222 17:83152777-83152799 CCCGAGCGACCCCTCTCTACCGG - Intergenic
1155508066 18:26550090-26550112 CCCTCGTGTCCCCTCACCCCAGG - Intronic
1155910498 18:31498999-31499021 CACGCCCCACCCCTCACTCCCGG + Intronic
1156171747 18:34494000-34494022 CCTGCGCGGCCCCGCGCCCCCGG - Intronic
1157095172 18:44680451-44680473 GCCGCGGGCCCCCGCACTCCCGG + Intronic
1157529346 18:48408831-48408853 CCCGCGCGCCACTTCGCTCCGGG + Intronic
1157613933 18:48975943-48975965 GCCGCCCCGCCCCCCACTCCTGG - Intergenic
1158647917 18:59264259-59264281 CCAGCTCCGCCCCTCACCCCAGG - Intergenic
1160673198 19:375989-376011 CCCCCGCGGCCTCACTCTCCCGG + Exonic
1161008950 19:1950817-1950839 CTCCCGCAGCCCCTCCCTCCTGG - Intronic
1161108707 19:2456640-2456662 CCCGCCCGGCCCCTAAGCCCCGG + Intronic
1161733710 19:5977863-5977885 CCGGCCCGGCCCATCACTCCCGG - Intronic
1161943245 19:7418980-7419002 CCCCAGCAGCCCCTCACCCCAGG + Intronic
1162534106 19:11253147-11253169 CCTGCCCTGCCCCTCCCTCCAGG + Intronic
1162798049 19:13096594-13096616 CCCACCCGGCCCCCCACCCCCGG - Intronic
1163617936 19:18340774-18340796 CCCTCTCGGCCCCGCAGTCCCGG - Intronic
1164990350 19:32677964-32677986 CCCGCGCTGCCCGCCCCTCCGGG + Exonic
1165080604 19:33303838-33303860 CCCGCGCCGCCCCTCGCCACTGG + Intergenic
1165319446 19:35076320-35076342 CCCGCCCGGCCTCTGATTCCTGG - Intergenic
1166255557 19:41601852-41601874 CCCAGGGGTCCCCTCACTCCAGG - Intronic
1166688330 19:44809019-44809041 CCCGCCCCGCCCCGCCCTCCAGG - Intergenic
1166807546 19:45496502-45496524 CCCGCGCGCGTCCTCGCTCCCGG + Intronic
1167074301 19:47239669-47239691 CCCGCGCCCCCCCTCCTTCCCGG + Intergenic
1167181795 19:47909624-47909646 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167182444 19:47915014-47915036 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167183780 19:47925716-47925738 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167184409 19:47930766-47930788 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167185081 19:47936117-47936139 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167377342 19:49119232-49119254 CCCGCGCGACCCCTCCCGGCCGG + Intergenic
1168095262 19:54110749-54110771 CCCACCCGGCCATTCACTCCTGG + Intronic
926250950 2:11155300-11155322 CCCGCCCCGCCCCTCCCGCCCGG - Intronic
926250967 2:11155329-11155351 CCCGCCCCGCCCCTCCCGCCCGG - Intronic
927142523 2:20140014-20140036 CTCCCGCGGCCCTTCACTCTGGG - Intergenic
929218153 2:39437242-39437264 CCCTCGCAGCCCCTCGCTCGGGG + Exonic
929575529 2:43049571-43049593 CCAGAAGGGCCCCTCACTCCCGG - Intergenic
929808796 2:45170411-45170433 CCCGCCCCGCACCTCCCTCCAGG - Intergenic
930033761 2:47073196-47073218 CCAGAGCTGCCCTTCACTCCAGG - Intronic
930046267 2:47175885-47175907 CCCGCGCGCCCCCTGGATCCCGG + Intronic
931762455 2:65430674-65430696 CGCGCGCGGGGCCTCCCTCCAGG + Intronic
932245175 2:70190764-70190786 CCCGCGCGAGCGCTCACTTCCGG + Intronic
935160774 2:100527700-100527722 CTCTCTCGGCTCCTCACTCCAGG + Intergenic
935301552 2:101697724-101697746 CCGCCGCGGCCCCACGCTCCGGG + Intronic
935736252 2:106108733-106108755 TCCTCGCTGCCCCTCACCCCCGG - Intronic
937445643 2:121955571-121955593 CCCGGGCAGCCCCTATCTCCTGG - Intergenic
938273103 2:129992811-129992833 CCCGAGCTGCCCCTCGCCCCCGG - Intergenic
938443121 2:131353295-131353317 CCCGAGCTGCCCCTCGCCCCCGG + Intronic
939990884 2:148875934-148875956 CCCGCCCGGCCCGCCGCTCCCGG - Intronic
940883547 2:158969271-158969293 CCCGCGCACCCCAACACTCCGGG - Intronic
941808485 2:169733687-169733709 CCCGCGCGCTCTCTCACACCCGG - Intronic
942452140 2:176114973-176114995 CCTGGCCGGCCCCTCACTCAGGG + Intronic
942454596 2:176129536-176129558 CCGCCGCGGCCCCTCCCTGCCGG + Intergenic
942454739 2:176130064-176130086 CCCGCGCGCCGCCGCCCTCCCGG - Exonic
942459773 2:176160755-176160777 CCCGCGCCCCCACCCACTCCTGG - Intronic
942967630 2:181916078-181916100 CACCCGCGGCGCCTCACTCTGGG - Exonic
943557321 2:189421618-189421640 CCCCCACAGCCCCTGACTCCAGG + Intergenic
944271281 2:197786693-197786715 CCCGCGCGGCCCCGCCCGCCTGG - Intronic
947739822 2:232479997-232480019 CCCCTGCTGCCCCTCACTTCAGG - Exonic
948645185 2:239400339-239400361 CCCGCCCCCGCCCTCACTCCCGG + Intronic
948867292 2:240782498-240782520 CCCGCCCCGCCCCTCACCACAGG + Intronic
948870094 2:240793406-240793428 ACAGCCAGGCCCCTCACTCCAGG + Intronic
949058497 2:241942998-241943020 CCAGTGCAGCCCCTGACTCCTGG - Intergenic
1168757382 20:326494-326516 CCCGAGCGGCCCGTCCCGCCGGG - Exonic
1168886848 20:1266270-1266292 CCCTCCCCGCCCCTCCCTCCCGG + Intronic
1170713239 20:18810557-18810579 CCCCCGCCGCCCCCCAGTCCAGG + Intronic
1171123711 20:22584905-22584927 GCCGCGGCGCCCCGCACTCCTGG + Intronic
1172662118 20:36574669-36574691 CCCGCGCGGGCCCGCCATCCCGG - Intronic
1172840830 20:37902013-37902035 CGGGCGAGGCCCCTGACTCCTGG - Intergenic
1173526809 20:43739007-43739029 CCCTCCCGGCCCCTCTCCCCTGG + Intergenic
1173605245 20:44326936-44326958 CGCGCGGGGCCCCGCAGTCCCGG - Intergenic
1174475767 20:50794909-50794931 CCCGCTCGGCCCGGCGCTCCTGG + Exonic
1175996996 20:62816480-62816502 CCACCGCGGCCCCTCACCCGTGG - Intronic
1176131604 20:63498875-63498897 CCCGCGCCGCCCCCCACCCCGGG + Intronic
1176336568 21:5604451-5604473 ACCGCTCTGCCCCTCCCTCCAGG - Intergenic
1176391189 21:6216497-6216519 ACCGCTCTGCCCCTCCCTCCAGG + Intergenic
1176470230 21:7099677-7099699 ACCGCTCTGCCCCTCCCTCCAGG - Intergenic
1176493791 21:7481455-7481477 ACCGCTCTGCCCCTCCCTCCAGG - Intergenic
1176506851 21:7656928-7656950 ACCGCTCTGCCCCTCCCTCCAGG + Intergenic
1178561558 21:33643058-33643080 CCCGGGCGGCCGCTCCTTCCCGG + Intronic
1179549862 21:42137199-42137221 CCCGCGCAGCCCCACCCTCAAGG + Intronic
1180042592 21:45287875-45287897 CCCGGGCGGCCACGCACTTCCGG + Exonic
1180072160 21:45441959-45441981 CCCCCTGGGACCCTCACTCCAGG + Intronic
1180235922 21:46459273-46459295 CCCGCGCAGCCCCTCACTCCGGG + Intronic
1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG + Intronic
1180236044 21:46459566-46459588 CCCGCGCGGCCCCTCACCCCGGG + Intronic
1180236081 21:46459656-46459678 CCCGCGCGGCCCCTCAAACCAGG + Intronic
1180461983 22:15573319-15573341 CCCGAGCTGCCCCTGGCTCCCGG + Intergenic
1180852812 22:19029923-19029945 CGCGCGCAGCGCCTCAATCCCGG - Intergenic
1180956969 22:19745577-19745599 CCTGCAGGGCCCCTCCCTCCAGG + Intergenic
1181687982 22:24542535-24542557 CCCTCCAGGCCCCTCTCTCCTGG - Exonic
1182904000 22:33920891-33920913 CCCGCGCGGCGGCCCACTCCTGG - Intronic
1183504679 22:38202467-38202489 CCTGCGCTGCCCCTTCCTCCCGG - Intronic
1184832483 22:46997722-46997744 CCCGCGCAGCCCCTCTCTGTGGG + Intronic
1185255421 22:49828399-49828421 GCCTCGGGGCCCCCCACTCCCGG - Intergenic
1185287416 22:50008728-50008750 CCTGCCCTGTCCCTCACTCCTGG + Intronic
1185296706 22:50058298-50058320 CCCGCGCAGCCCCACGCCCCGGG - Intergenic
1185296945 22:50059011-50059033 CCCACCAGGACCCTCACTCCTGG + Intergenic
1185313811 22:50170417-50170439 CCCGCCCGCCCCCTGACCCCGGG + Intergenic
950362952 3:12462651-12462673 CCAGCACGGCCCCTCTCTCCTGG + Intergenic
950447094 3:13044684-13044706 CCCCCGCCCCCCCACACTCCTGG + Intronic
950649922 3:14401048-14401070 CCCGGGTGGCCCCTTCCTCCAGG - Intergenic
950880976 3:16322451-16322473 CCTGCTCGGCTCCTCACTCCTGG - Intronic
953439653 3:42906539-42906561 CCCTCGAGGCCCCTCACTCTGGG - Intronic
953705441 3:45226516-45226538 CCCGGGCGCCCCCGCGCTCCGGG + Intergenic
953815543 3:46153459-46153481 CCCTCTCTGCCCCTCCCTCCAGG + Intergenic
953897299 3:46812262-46812284 CCCCAGCGGCCCCCCAGTCCAGG - Exonic
954275634 3:49539983-49540005 CCCGCTCGGCCCCGCGCTGCCGG - Intergenic
955325669 3:58008175-58008197 CCCGCGGGTCCCCCCACCCCGGG + Intergenic
957081691 3:75641554-75641576 ACCGCTCTGCCCCTCCCTCCAGG - Intergenic
961762828 3:129184064-129184086 CGCGCGCGGCCTTTCACGCCGGG + Intergenic
962222472 3:133574521-133574543 CCCGGGCGGCGCCACCCTCCGGG + Intronic
964607069 3:158571362-158571384 CCCGCGCGACCCCGGACTCCTGG - Intronic
965590399 3:170356899-170356921 CCCCCGCGGGACCTCCCTCCTGG - Intergenic
967870520 3:194225360-194225382 GCCCAGCGGCCCCTCCCTCCAGG - Intergenic
968878788 4:3288176-3288198 CCCGCCGGGCCCATCACTCTTGG - Intergenic
968900992 4:3431713-3431735 CCTGAGCGGCTCCTCTCTCCAGG - Intronic
969307605 4:6334856-6334878 CCCGAGAGGCCCCTCCCTGCTGG + Intronic
972913353 4:43846476-43846498 CCCGCGCGGCCCAAGCCTCCCGG + Intergenic
973236767 4:47914287-47914309 CTCACTCGGCCCCTCACACCGGG - Intronic
975588033 4:75970695-75970717 CCCACGAGGTCCCTCCCTCCAGG - Intronic
975870680 4:78776065-78776087 CCCGCGCCGCCCGCCACTCGTGG - Intergenic
985449179 4:190049426-190049448 ACCGCTCTGCCCCTCCCTCCAGG + Intergenic
985579819 5:690703-690725 CCCCTGCGGCCCCTCCCTCCGGG + Intronic
985594665 5:782762-782784 CCCCTGCGGCCCCTCCCTCCGGG + Intergenic
985994809 5:3591988-3592010 CCCGCCCTGCCCCACCCTCCTGG - Intergenic
988702614 5:33690173-33690195 CCCGAGGGGCCCATCTCTCCAGG + Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
992772137 5:80058911-80058933 CCCACGCAGCCCCGCACGCCAGG + Intronic
998467517 5:142357372-142357394 CGCGCGCCGCCCTTCTCTCCGGG + Intergenic
1003074362 6:2971014-2971036 CCCGCCCGGCTCCTAACACCCGG + Intronic
1004561888 6:16760296-16760318 GCCGCGCAGCCGTTCACTCCCGG + Intronic
1007126718 6:39431868-39431890 TCTGCGCTGACCCTCACTCCGGG - Intronic
1007423909 6:41735050-41735072 CCCGCCCGGCCCCTCCCGCCCGG + Intronic
1007423938 6:41735110-41735132 CCCCCTCGGCCCCTCCCTTCAGG - Intronic
1016934865 6:149441965-149441987 CCCGTGCGGGCCCTGGCTCCTGG - Intergenic
1018813831 6:167316588-167316610 CCCCCCCACCCCCTCACTCCTGG + Intergenic
1019274900 7:171122-171144 TCCGTGGGGCCCCTCACTTCTGG - Intergenic
1019299153 7:294882-294904 CCCGCCCGGCCCCCAAGTCCAGG + Intergenic
1023405873 7:39833490-39833512 CCCGCGCTGCTCCTCGCTCCCGG - Intergenic
1023821250 7:43981798-43981820 CCTGCGGGGCCCCTCACCCATGG + Intergenic
1025149551 7:56538111-56538133 ACCGCGCTGGCCCTCTCTCCTGG - Intergenic
1025639549 7:63353857-63353879 ACCACGCGGCCCCTTCCTCCAGG + Intergenic
1025643150 7:63394235-63394257 ACCACGCGGCCCCTTCCTCCAGG - Intergenic
1029145593 7:98443529-98443551 CCTGCGCTGCCCCTGACACCAGG - Intergenic
1029749519 7:102535222-102535244 CCTGCGGGGCCCCTCACCCATGG + Intergenic
1029767467 7:102634325-102634347 CCTGCGGGGCCCCTCACCCATGG + Intronic
1034243043 7:149624367-149624389 CCAGCCGGGCCCCCCACTCCGGG - Intergenic
1034947253 7:155270463-155270485 CCTGCCCTGCCCTTCACTCCTGG - Intergenic
1035795839 8:2355726-2355748 CCCTCTGGGCACCTCACTCCAGG - Intergenic
1036613902 8:10373705-10373727 CCGGCACGTGCCCTCACTCCTGG - Intronic
1037841086 8:22245540-22245562 CCGGCGCCTCCCCTCACCCCCGG + Exonic
1039875104 8:41578351-41578373 CCCGCGCGGCCGCCCAAGCCCGG - Intronic
1041673665 8:60517052-60517074 TCCTCACAGCCCCTCACTCCCGG + Exonic
1044815410 8:96107685-96107707 CCCGCTCTCTCCCTCACTCCAGG - Intergenic
1044875473 8:96661445-96661467 CCCTCCCTTCCCCTCACTCCTGG + Intronic
1045844544 8:106618012-106618034 CCCGCCCGGTCCCTGACCCCTGG - Intronic
1046067145 8:109210912-109210934 CCCGCGCGGCCCCGAACCCCAGG - Intergenic
1047199893 8:122756135-122756157 CCCACGTGGCCTCTGACTCCTGG - Intergenic
1049569031 8:143359823-143359845 CCCGCCTGACCCCTCCCTCCTGG + Intronic
1051287263 9:15510366-15510388 CCCTTGCGGCCCCTCCCTTCGGG - Intronic
1051774499 9:20620509-20620531 CCCGCGCGGCGCCGCGCACCCGG + Intronic
1053114596 9:35490057-35490079 CGCCGGCGGCCCCTCCCTCCGGG - Intergenic
1056935596 9:90913093-90913115 CCCGCCCTGCCACTCTCTCCTGG + Intergenic
1057211172 9:93201914-93201936 CCCGCGCTCCCACTCACTGCAGG + Intronic
1060106522 9:120876579-120876601 CCCGCCCGGCCCCGCGCTCCCGG - Intronic
1061843782 9:133375767-133375789 CCCGCCCGGGCCCTCTGTCCCGG - Intronic
1061877815 9:133553756-133553778 CCCCTGCTGCCCCTCTCTCCAGG - Intronic
1062312130 9:135944595-135944617 CCTGAGCGGCCCCTCGCTCATGG + Intronic
1062330171 9:136038129-136038151 CCCCCGCTTCCCCTGACTCCCGG - Intronic
1062333112 9:136053165-136053187 ACAGCCCTGCCCCTCACTCCCGG + Intronic
1062413620 9:136437154-136437176 CAGGCACGGGCCCTCACTCCAGG + Intronic
1062440888 9:136568781-136568803 TCCCTGCGGCCCCTCACCCCGGG + Intergenic
1062493780 9:136822086-136822108 CCCACCCGGCTCCTCTCTCCTGG - Intronic
1203425080 Un_GL000195v1:30451-30473 ACCGCTCTGCCCCTCCCTCCAGG + Intergenic
1187181382 X:16946691-16946713 GCCGCGCGGCCGCTTCCTCCCGG - Exonic
1189114273 X:38327287-38327309 CGCCCGCGGACCCTCCCTCCCGG + Intronic