ID: 1180235932

View in Genome Browser
Species Human (GRCh38)
Location 21:46459299-46459321
Sequence CCCGCGCGGCCCCTCACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 2, 2: 3, 3: 24, 4: 260}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180235924_1180235932 -6 Left 1180235924 21:46459282-46459304 CCCCTCACTCCGGGACCCCCGCG 0: 1
1: 0
2: 1
3: 20
4: 145
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235916_1180235932 11 Left 1180235916 21:46459265-46459287 CCCGGTCCCCCGCGCAGCCCCTC 0: 1
1: 0
2: 5
3: 53
4: 451
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235915_1180235932 17 Left 1180235915 21:46459259-46459281 CCTCAGCCCGGTCCCCCGCGCAG 0: 1
1: 1
2: 6
3: 32
4: 342
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235914_1180235932 18 Left 1180235914 21:46459258-46459280 CCCTCAGCCCGGTCCCCCGCGCA 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235921_1180235932 3 Left 1180235921 21:46459273-46459295 CCCGCGCAGCCCCTCACTCCGGG 0: 1
1: 0
2: 3
3: 25
4: 273
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235912_1180235932 22 Left 1180235912 21:46459254-46459276 CCCGCCCTCAGCCCGGTCCCCCG 0: 1
1: 0
2: 7
3: 71
4: 535
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235917_1180235932 10 Left 1180235917 21:46459266-46459288 CCGGTCCCCCGCGCAGCCCCTCA 0: 1
1: 0
2: 1
3: 36
4: 345
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235925_1180235932 -7 Left 1180235925 21:46459283-46459305 CCCTCACTCCGGGACCCCCGCGC 0: 1
1: 0
2: 7
3: 17
4: 150
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235911_1180235932 28 Left 1180235911 21:46459248-46459270 CCGCGACCCGCCCTCAGCCCGGT 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235926_1180235932 -8 Left 1180235926 21:46459284-46459306 CCTCACTCCGGGACCCCCGCGCG 0: 1
1: 0
2: 0
3: 14
4: 121
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235908_1180235932 30 Left 1180235908 21:46459246-46459268 CCCCGCGACCCGCCCTCAGCCCG 0: 1
1: 0
2: 0
3: 30
4: 259
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235909_1180235932 29 Left 1180235909 21:46459247-46459269 CCCGCGACCCGCCCTCAGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 276
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235918_1180235932 5 Left 1180235918 21:46459271-46459293 CCCCCGCGCAGCCCCTCACTCCG 0: 1
1: 0
2: 2
3: 26
4: 270
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235913_1180235932 21 Left 1180235913 21:46459255-46459277 CCGCCCTCAGCCCGGTCCCCCGC 0: 1
1: 1
2: 2
3: 65
4: 622
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235919_1180235932 4 Left 1180235919 21:46459272-46459294 CCCCGCGCAGCCCCTCACTCCGG 0: 1
1: 0
2: 4
3: 21
4: 248
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260
1180235923_1180235932 2 Left 1180235923 21:46459274-46459296 CCGCGCAGCCCCTCACTCCGGGA 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG 0: 1
1: 2
2: 3
3: 24
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180235932 Original CRISPR CCCGCGCGGCCCCTCACTCC AGG Intronic