ID: 1180242948

View in Genome Browser
Species Human (GRCh38)
Location 21:46524050-46524072
Sequence TCCAGCTGTCCCGTCAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180242947_1180242948 4 Left 1180242947 21:46524023-46524045 CCGCTTGTCAGTAATGAAGGGAT 0: 1
1: 2
2: 12
3: 32
4: 123
Right 1180242948 21:46524050-46524072 TCCAGCTGTCCCGTCAGCTCTGG 0: 1
1: 0
2: 1
3: 19
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180242948 Original CRISPR TCCAGCTGTCCCGTCAGCTC TGG Intronic
900309290 1:2025544-2025566 GCCTGCTGTCCCGCCAGCTCTGG - Exonic
900613926 1:3555914-3555936 TCAAGCTGTCCCATCATCTCTGG + Intronic
902482427 1:16718856-16718878 TCCAGTGGTCCCCTCAGCCCAGG - Intergenic
906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG + Intronic
907216292 1:52867733-52867755 TCAAGCTGTGCCGTTTGCTCAGG - Exonic
912382522 1:109255096-109255118 TCCTCCTGGCCCGGCAGCTCTGG + Intronic
913153196 1:116066177-116066199 ACAAGATGTCCTGTCAGCTCTGG + Intronic
914939969 1:152014053-152014075 TCCATCTGTTCCCTCAGTTCTGG - Intergenic
915004368 1:152622994-152623016 TCCAGCTGTGCCCCAAGCTCTGG - Exonic
915020732 1:152776495-152776517 TCCTGCTGCAGCGTCAGCTCCGG + Exonic
915103347 1:153516165-153516187 TCCAGCTGTCCTGACACCTAGGG - Intergenic
917243193 1:172971871-172971893 TCCCGGTGTCCAGTCAGCACAGG - Intergenic
920667102 1:207971018-207971040 ACCATCTGTCTCGTCAGCACTGG + Intergenic
920951265 1:210573699-210573721 GCCAGCTGTCCCTTTTGCTCAGG + Intronic
922822538 1:228494153-228494175 TCCATGAGTCCCGGCAGCTCTGG + Exonic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1062903311 10:1162064-1162086 TTCACCTCTCCCGTCTGCTCAGG - Intergenic
1068117291 10:52749277-52749299 TCCAGCTGTCATGTGAGATCAGG - Intergenic
1068892285 10:62160490-62160512 CCCAGCTATCCCTTCAGCACAGG + Intergenic
1068965147 10:62904377-62904399 TCCAGATGTCCTGGCAGCTGAGG - Intronic
1069441497 10:68432881-68432903 TCTATCTGTCCCTTAAGCTCTGG + Intronic
1070167712 10:73911170-73911192 TCCACCTGTCCCCGCAGCGCCGG + Exonic
1070767566 10:79065553-79065575 TCCTGTTGTCCCCTCAGCCCTGG - Intergenic
1070814525 10:79314333-79314355 TCCTGCTCTCCCGTCCGCTGTGG + Exonic
1073619971 10:105036540-105036562 TCCAGCTGTCACCTGACCTCAGG - Intronic
1074572041 10:114632945-114632967 TCCTGCTGTCCTGTGAGCTGAGG + Intronic
1075733254 10:124648762-124648784 TCCACCTGTCCCGCCTGTTCGGG + Intronic
1076212158 10:128657553-128657575 CCCAGCTGCCCTGACAGCTCAGG + Intergenic
1076400455 10:130180720-130180742 TGCTGCTGTCTCTTCAGCTCAGG + Exonic
1076909758 10:133381116-133381138 TCGGGCTGTCCCGTCACCCCTGG + Intronic
1077606735 11:3617372-3617394 TCCAGCTTAGCCGTGAGCTCAGG + Intergenic
1078036508 11:7811072-7811094 TCCAGCTGGCCCCTCTGTTCGGG + Intergenic
1078755326 11:14203561-14203583 TCCATCTGTCACGTCTGTTCTGG - Intronic
1081545221 11:44066678-44066700 TCCAGCTCTCCCGACAGCCCAGG - Exonic
1081929319 11:46857790-46857812 TCCAGCTGTCCCCTCAGCTAAGG - Exonic
1082104895 11:48211149-48211171 TCCTTCAGTCCCGTCAGCCCTGG + Intergenic
1083008275 11:59368938-59368960 TCCAGCTGTCCTGTAAGCCTAGG + Intergenic
1083545958 11:63549594-63549616 GCCAGCTGTCCCGTCACTCCTGG - Intergenic
1085695935 11:78704848-78704870 TCCATCTGTCCCTGCAGCTCAGG + Intronic
1089201545 11:116727443-116727465 TCAGGCTGTCCCCTCACCTCGGG - Intergenic
1089912976 11:122121993-122122015 TCCATCTCTCCCTCCAGCTCTGG - Intergenic
1090863263 11:130673079-130673101 TCCAGCCGTCCTGTGAGCTCAGG + Exonic
1091351786 11:134903660-134903682 TCCCACTGTCCCCTCTGCTCTGG - Intergenic
1091788087 12:3255198-3255220 TCTGTCTGTCCCGCCAGCTCCGG + Intronic
1093663832 12:21788825-21788847 TCCAGCTATTCAGGCAGCTCAGG - Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1096524247 12:52201152-52201174 TGCAGCTGTGTCCTCAGCTCAGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1099395153 12:82129247-82129269 TCCAGCTGTTCCATAAGCTGAGG + Intergenic
1103527824 12:121579439-121579461 TCCAGCTTCCCCGGTAGCTCGGG - Intronic
1104036045 12:125097685-125097707 TCCCCCTGTCCAGTCAGCACTGG + Intronic
1105217210 13:18295241-18295263 CCCACCTGTCCAGTCAGCCCTGG + Intergenic
1106788122 13:33127504-33127526 TCCAGCTGTCGCACCAGCCCCGG - Exonic
1107462411 13:40616839-40616861 TCCATCTGTCCCTTTTGCTCTGG - Intronic
1109262780 13:60163762-60163784 TCCATCTTTCCCCGCAGCTCCGG + Exonic
1109405630 13:61894651-61894673 TCCAACAGTTCTGTCAGCTCTGG + Intergenic
1110085535 13:71374450-71374472 TCCATCTCTCCCCTCAGCTCTGG - Intergenic
1112395238 13:99023991-99024013 TCCAACTGACCCCTCAGCTCAGG + Intronic
1112416335 13:99206273-99206295 TCCAACTGTCCCCCCACCTCTGG - Intronic
1112895252 13:104291901-104291923 TACAGCTGTCCCGACAGCTATGG + Intergenic
1113387193 13:109859612-109859634 TCCAGCTGCCCCTGCAGCTCAGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116910336 14:50456526-50456548 TGAAGCTGTCCGTTCAGCTCTGG + Exonic
1122466743 14:101938856-101938878 GCAAGCTGTCCCGTCTGCACTGG - Intergenic
1123193455 14:106593198-106593220 CCCAGCTGACCCTGCAGCTCTGG - Intergenic
1123199006 14:106643657-106643679 CCCAGCTGACCCTGCAGCTCTGG - Intergenic
1123872168 15:24587636-24587658 TCCAGCTGATCCTTCAGCTCAGG + Intergenic
1124343099 15:28902472-28902494 TTCAGCTGTCGCGTCTCCTCAGG - Intronic
1124621165 15:31274890-31274912 TCCAGCTGTTCTGGGAGCTCAGG - Intergenic
1125762213 15:42104321-42104343 AACAGCGGTCCCGTCAGCTGTGG + Intergenic
1129756871 15:78104040-78104062 TCCAGCTGTACCCTCAGGTCAGG + Exonic
1130763623 15:86847813-86847835 CACAGCTTTCCAGTCAGCTCAGG + Intronic
1132726744 16:1342207-1342229 TCCTGCTGTCCCGTTTGCGCGGG - Exonic
1132842705 16:1986040-1986062 GCTAGCTGTCCCATGAGCTCTGG - Exonic
1133344424 16:5060411-5060433 TCCAGCTGACCCTCCAGCCCGGG - Exonic
1134047230 16:11109701-11109723 TCCAGGTGTCCTATCAGCTGTGG + Intronic
1134102900 16:11464978-11465000 TCCAGCTCTGCCGTCAGCCTGGG - Intronic
1135666261 16:24337971-24337993 TCCAGCTGTCTTTTCAGCACAGG - Intronic
1135666269 16:24338019-24338041 TCCAGCTGTCTTTTCAGCACAGG - Intronic
1138647872 16:58438356-58438378 TCAAGATCCCCCGTCAGCTCAGG - Intergenic
1142815180 17:2419674-2419696 TCAAGCTGGCCCCTCAGCTCTGG - Exonic
1142900446 17:3008232-3008254 TCCAGCTGGCCCTTGGGCTCTGG - Intronic
1142970844 17:3610598-3610620 TGCAGCTGTCGGGGCAGCTCTGG - Exonic
1142982336 17:3679484-3679506 TCCAGCGGACCCCTCTGCTCTGG - Intronic
1143330632 17:6132432-6132454 CCCAGCAGTCCCGTGAGCTCTGG - Intergenic
1148119119 17:45197451-45197473 TCCAGCTCTACCCTGAGCTCTGG + Intergenic
1151431664 17:74067683-74067705 TCCAGCTGGCCAATGAGCTCAGG + Intergenic
1152101567 17:78304729-78304751 TCCGGATGTCCAGCCAGCTCTGG + Intergenic
1152839970 17:82561167-82561189 TCCACCAGTGCCATCAGCTCTGG - Intronic
1152928154 17:83097331-83097353 TCCAGCTGCCTGCTCAGCTCTGG + Intergenic
1153989598 18:10384786-10384808 TCCAGCTCTCAAGTCAGCTCTGG + Intergenic
1157523122 18:48359006-48359028 TCCTGCTGTCCTGTGAGCTCTGG + Intronic
1160734006 19:653558-653580 TCCAGCAGGCCCTTCAGCCCTGG - Intronic
1160817617 19:1043373-1043395 ACCCGCTGTCCCGCCTGCTCTGG + Exonic
1162351463 19:10152498-10152520 TCCTGCAGTCCCGGCAACTCAGG + Intronic
1163003091 19:14381353-14381375 TCCAGCTGCACCGCCAGTTCCGG + Intronic
1163063604 19:14776910-14776932 TCCAGCTGCACCGCCAGTTCCGG - Exonic
1163663263 19:18590881-18590903 TCCTCCTGCCCCGCCAGCTCTGG - Exonic
1166375467 19:42324768-42324790 TCCCGCTGTTCCGTGACCTCCGG + Exonic
927081115 2:19631479-19631501 TCCAGCTGTTCCTGAAGCTCAGG + Intergenic
927291096 2:21405613-21405635 TCCAGTTGTCCCTTCACCCCTGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
932420043 2:71596228-71596250 TCCAGCAGCCCCATCAGCCCAGG - Intronic
933458939 2:82554286-82554308 TCCAGCTGTCCACTTAGCACTGG + Intergenic
934297114 2:91751442-91751464 CCCACCTGTCCAGTCAGCCCTGG - Intergenic
934476092 2:94594595-94594617 TCCAGCTGTCCCAGCTGCCCCGG + Intronic
936816846 2:116470642-116470664 TCCAGCTGGTCCGTCCGTTCGGG + Intergenic
937725902 2:125166226-125166248 TCCTCCTGGCCCCTCAGCTCTGG - Intergenic
939469261 2:142598824-142598846 TCCAGCTGTCTCCTCTGCTGAGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
945943003 2:215968452-215968474 TCAAGCTGTCCCATGAGCTTTGG - Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948689758 2:239694484-239694506 TCCAGCTCTTCCCTCTGCTCTGG - Intergenic
1171975678 20:31593451-31593473 TCCAGCTGCACCCTCACCTCAGG - Intergenic
1172320406 20:33992019-33992041 TCCAGCCTTCCCATCAGTTCTGG + Intergenic
1173489380 20:43467353-43467375 CCCACCTGTCCCATCTGCTCAGG + Intergenic
1174107713 20:48174638-48174660 TCCTTGTGTCCAGTCAGCTCAGG - Intergenic
1176196485 20:63838749-63838771 TAGAGCTGTCCCGTCTCCTCGGG - Intergenic
1179531969 21:42025948-42025970 TCCAGCTGTCCCGTGAGGAGGGG - Intergenic
1180046881 21:45310665-45310687 ACCAGCTGCCCGGTCTGCTCTGG + Intergenic
1180242948 21:46524050-46524072 TCCAGCTGTCCCGTCAGCTCTGG + Intronic
1180879832 22:19195913-19195935 TCCTTCTGCCCTGTCAGCTCAGG - Intronic
1184689741 22:46112121-46112143 TCCTGCAGTGCGGTCAGCTCAGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953558112 3:43962978-43963000 TCCAGCTTCCTTGTCAGCTCGGG + Intergenic
954377622 3:50203481-50203503 TCCAGCTGTCCGGTCACCACAGG + Intergenic
954661583 3:52229568-52229590 TCCTGCTCTGCCGTCATCTCAGG + Intronic
954870688 3:53765272-53765294 GACAGCTGACCCCTCAGCTCAGG - Intronic
959615763 3:108345583-108345605 ACCAGCTGACCCGTCTCCTCTGG + Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961493607 3:127274607-127274629 TCCAGTTGTCTGCTCAGCTCTGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
968451121 4:676514-676536 TGCAGCTGTCAGGTCAGCTGTGG + Intronic
968948451 4:3677819-3677841 TCCCGCTCTCCCTGCAGCTCGGG + Intergenic
974732339 4:65884629-65884651 GCCAGCACTCCCGTCAGCTGAGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
983162261 4:164430988-164431010 CCCAGCAGTCCCTTCAGCTGAGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
994875862 5:105420000-105420022 TCCAGCTGGTCCTTCTGCTCAGG + Intergenic
997316867 5:132943867-132943889 TCCGTCTTTCCCTTCAGCTCAGG - Intronic
998404715 5:141867803-141867825 TCCCGCTGTCATCTCAGCTCTGG - Intronic
998492840 5:142562276-142562298 TTCAGCTGGCCCGTCTGTTCTGG + Intergenic
1003624592 6:7729340-7729362 TCCAGGTTTCCTGGCAGCTCTGG + Intronic
1005871497 6:29977081-29977103 TCCAGCTGCTCCGTCACCCCAGG + Intergenic
1009220357 6:60976064-60976086 TCCAGCTCACCTGTCACCTCTGG - Intergenic
1009985053 6:70771955-70771977 TGGAGCTGTCCCGTCTGCCCAGG + Intronic
1010203904 6:73306598-73306620 TCCAGCAGTCCAGTCAGATGAGG - Intronic
1011262100 6:85480563-85480585 TCCAGCTCTCCAGTCAGGCCTGG - Intronic
1014289299 6:119539825-119539847 TCCTGTTGTCCATTCAGCTCTGG - Intergenic
1015275678 6:131381300-131381322 TCCAGCTGTCGCTCCAGCTGGGG + Intergenic
1018936369 6:168276304-168276326 TCCTCCTGTCCCCTCAGCCCCGG - Intergenic
1019147300 6:169983552-169983574 TGCTGCGGTCCCGTCAGCTCAGG - Intergenic
1019419708 7:945388-945410 TCCAGCTGCCCCCTCCACTCGGG + Intronic
1019894433 7:3972686-3972708 CACAGCTGTCCCCTCTGCTCGGG - Intronic
1020279575 7:6643413-6643435 TCCTGCTGCCCAGTCAGGTCAGG + Intronic
1022092648 7:27117663-27117685 TCCAGCTGCTCCGGCTGCTCAGG + Intronic
1022249742 7:28595319-28595341 GCCAGATGTTCCATCAGCTCAGG + Intronic
1023033006 7:36107403-36107425 TCCTGCTGCACCATCAGCTCCGG - Intergenic
1023037987 7:36149625-36149647 TCCTGCTGCACCATCAGCTCCGG + Intergenic
1028933668 7:96442262-96442284 TCCACCTTTCCAGTCAGCTGGGG + Intergenic
1029460993 7:100693906-100693928 TCCCGCTCTCCCGCCCGCTCCGG - Intergenic
1032089465 7:128904028-128904050 TCCACCTGTCCCCTCTGCCCAGG - Intronic
1032530289 7:132614669-132614691 TGCCTCTGTCCCGTCAGCTGTGG - Intronic
1033224412 7:139549255-139549277 TCCAGCTGTCTCCTCATCACTGG - Intergenic
1033823208 7:145158921-145158943 TCAAGCTGTCCCTGCTGCTCTGG + Intergenic
1034200614 7:149281207-149281229 TCCAGCTGACCCCTGACCTCTGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035666964 8:1386448-1386470 CCCAGCTGTCCCTGCCGCTCTGG - Intergenic
1035813231 8:2511108-2511130 TGCAGCTATCCTGACAGCTCTGG - Intergenic
1037504762 8:19518754-19518776 TCCAGCTAGGCCGTCAGCACAGG + Intronic
1040014749 8:42691298-42691320 GCCCTCTGTCCCCTCAGCTCTGG + Intergenic
1040663989 8:49609150-49609172 TCAGGCTGTCACATCAGCTCAGG - Intergenic
1041330168 8:56715706-56715728 TCCAGCTGTCCCAGCTACTCAGG + Intergenic
1045355660 8:101386756-101386778 TCAAGCTGTTCTTTCAGCTCAGG + Intergenic
1046898909 8:119502663-119502685 TTCTGCTGTCCTTTCAGCTCCGG - Intergenic
1046903563 8:119547897-119547919 TCCAACTGTCTTGTCATCTCTGG - Intergenic
1047753379 8:127899422-127899444 TCCGGCTGTTGAGTCAGCTCAGG + Intergenic
1048468395 8:134686078-134686100 TGCAGCTGCCCTGACAGCTCAGG + Intronic
1049910004 9:256711-256733 TCCAGCGATCCTTTCAGCTCAGG - Intronic
1053123623 9:35562903-35562925 TCCAGCTGCCCCTCCGGCTCTGG + Exonic
1053681965 9:40491483-40491505 TCCAGCTGTCCCAGCTGCCCCGG - Intergenic
1054281748 9:63133449-63133471 TCCAGCTGTCCCAGCTGCCCCGG + Intergenic
1054295061 9:63326986-63327008 TCCAGCTGTCCCAGCTGCCCCGG - Intergenic
1054393083 9:64631486-64631508 TCCAGCTGTCCCAGCTGCCCCGG - Intergenic
1054427732 9:65136696-65136718 TCCAGCTGTCCCAGCTGCCCCGG - Intergenic
1054502644 9:65884842-65884864 TCCAGCTGTCCCAGCTGCCCCGG + Intronic
1056693494 9:88827472-88827494 TGCCGCTGTCCCCTCACCTCTGG - Intergenic
1056880481 9:90387046-90387068 CCCAGCTGGCCCCTGAGCTCTGG - Intergenic
1058541562 9:106017637-106017659 TTCAGCAGTCCCGTAAGCTGTGG - Intergenic
1058623775 9:106913040-106913062 TCCAGGTGTCACATCAGTTCAGG + Intronic
1060128823 9:121075384-121075406 CCCAGCTCTCCCCTCAGCTCAGG - Intronic
1061573193 9:131490247-131490269 TTCAGCAGGCCTGTCAGCTCTGG + Intronic
1062113667 9:134796381-134796403 GCCAGCTGGGCCGTCACCTCCGG - Exonic
1062125531 9:134858880-134858902 TCCAGTTGTCTCCTCAGCCCTGG - Intergenic
1062392277 9:136338563-136338585 TGCAACTGTCTCGGCAGCTCAGG + Exonic
1195091360 X:101462857-101462879 TGCAGCTTTCCCTTCAGCTCAGG + Intronic
1199544818 X:148996737-148996759 TCCATCTCTCCTTTCAGCTCAGG - Exonic
1199971462 X:152864922-152864944 TCCTGCTGTCATGTCACCTCGGG - Intronic
1200062181 X:153488578-153488600 TCCAGCTGGCCCCTCAGATATGG + Intronic
1200246577 X:154529742-154529764 GGCAACTGTCCCTTCAGCTCTGG - Intergenic