ID: 1180248323

View in Genome Browser
Species Human (GRCh38)
Location 21:46563117-46563139
Sequence GGAGGCTCCAACAGCATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180248311_1180248323 29 Left 1180248311 21:46563065-46563087 CCTGGAAAGAGCTCTGGTTTTGG 0: 1
1: 0
2: 1
3: 25
4: 204
Right 1180248323 21:46563117-46563139 GGAGGCTCCAACAGCATCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180248323 Original CRISPR GGAGGCTCCAACAGCATCTG GGG Intronic
900975450 1:6013514-6013536 GGATGCCCGACCAGCATCTGAGG + Intronic
901403691 1:9031960-9031982 GGAGGCTGCAGCTGCACCTGGGG + Intergenic
902296355 1:15469863-15469885 GGTGACTCCCACAGCAGCTGGGG - Intronic
902299149 1:15489135-15489157 GGTGACTCCCACAGCAGCTGGGG - Intronic
903462896 1:23531428-23531450 GGCGGCACCAACAGCAGGTGTGG - Intergenic
903765736 1:25733044-25733066 GGAGGCTCCCCCAGGAGCTGAGG + Intronic
905938176 1:41841207-41841229 GAAGGCTGCATCAGAATCTGTGG + Intronic
906082553 1:43102680-43102702 GGGGGCTGCAACAGCACCTGGGG + Intergenic
906724435 1:48033682-48033704 GGGGGCTGCAGCAGCAGCTGGGG + Intergenic
906987813 1:50705309-50705331 ATAGTCTCCAACAGCATCTTAGG + Intronic
914742080 1:150473113-150473135 GGAGGCAGCAACAGCAGCAGTGG + Exonic
917789647 1:178491342-178491364 GGAGGCTCCATTTGAATCTGAGG - Intergenic
921245259 1:213232059-213232081 GCAGGCTCCAAAGGCAACTGAGG + Intronic
921373244 1:214447270-214447292 GGAGGTTTTAGCAGCATCTGAGG - Intronic
921903921 1:220476203-220476225 GGAGGCGCCAAGAGCAAGTGAGG + Intergenic
921951953 1:220939367-220939389 GGCAGCTCCACCAGCCTCTGTGG - Intergenic
922450576 1:225734084-225734106 TGAGGCCCAAACAACATCTGTGG + Intergenic
922809628 1:228408391-228408413 GGAGGCTCCATCAGCATGACCGG + Exonic
923985414 1:239376453-239376475 AGAGGCTCCAACTGAATCTCTGG - Intergenic
1064338788 10:14468131-14468153 GCAGGCTCCAAGAACGTCTGAGG + Intergenic
1067045012 10:42980624-42980646 GGTGGGTCCAACATCCTCTGCGG + Intergenic
1068214532 10:53967080-53967102 GGTCCCTCCAACAGCATGTGGGG - Intronic
1068864062 10:61876352-61876374 GGAAGCTCCACCAGCATTTGCGG + Intergenic
1069668087 10:70177879-70177901 GCAGGGTCCAAAAGCCTCTGAGG - Intergenic
1070648156 10:78215735-78215757 AGAGGCTCCAAGAGCCACTGGGG - Intergenic
1071457490 10:85862029-85862051 GGAGGGGACAACAGCAACTGGGG - Intronic
1072097709 10:92198586-92198608 GAAAGGGCCAACAGCATCTGGGG + Intronic
1072740046 10:97903765-97903787 GGAGGTGCCAACAGCATGAGGGG - Intronic
1073435109 10:103511410-103511432 GAATTCTCCAGCAGCATCTGAGG + Intronic
1074589253 10:114797138-114797160 GGAGGTTCCAACAACGTCTGGGG - Intergenic
1076643732 10:131936979-131937001 GGCGGCTGCAACACCATCCGCGG - Intronic
1076686644 10:132201168-132201190 TGAGACTCCAACAGCAACAGGGG + Intronic
1077432809 11:2524387-2524409 TGAGGCTCCAAGGGCTTCTGAGG - Intronic
1081991229 11:47338718-47338740 GGAGGCTGCAAGGGCCTCTGGGG - Intronic
1083998649 11:66284325-66284347 GGGGGCTCCAGCAGGGTCTGTGG - Intronic
1084492338 11:69485722-69485744 GGAGGCAAGTACAGCATCTGTGG + Intergenic
1085127238 11:74010266-74010288 GGAGCCTCCAGTAGCTTCTGTGG - Intergenic
1087244019 11:95812886-95812908 GGATGCTGTAACAGCATATGCGG - Intronic
1087823487 11:102737885-102737907 GGAAGCTCCATCAGGATGTGTGG - Intergenic
1087922542 11:103882941-103882963 GGAGACTCAAGAAGCATCTGGGG + Intergenic
1091550172 12:1530647-1530669 GGAGGCTGCCCCAGCATCGGGGG + Intronic
1096103611 12:48983997-48984019 GGAGGCACCAACAGCAGAAGAGG - Intergenic
1096617037 12:52839234-52839256 GGAGGCTCCAACATCATTCTGGG - Exonic
1097299137 12:57998769-57998791 GGTGGCTGCAGCAGCACCTGGGG + Intergenic
1100134788 12:91542332-91542354 GCAAGCTCCAACACCATTTGAGG - Intergenic
1101437656 12:104677848-104677870 AGAGGCTGGAACAGCAACTGAGG - Intronic
1102790914 12:115644464-115644486 GGGCGCTCCAACAGCAAATGGGG - Intergenic
1108066651 13:46584599-46584621 ACAGGCTCCAACAGGAGCTGAGG - Intronic
1112577992 13:100653943-100653965 GCAGGCACCAACAGCCTCTTTGG - Intronic
1115787913 14:36847076-36847098 AAAGACCCCAACAGCATCTGGGG - Intronic
1117239789 14:53818444-53818466 GGAGTCTCCTCCATCATCTGTGG - Intergenic
1121903070 14:97712145-97712167 CTGGGCTCCAACAGCATCTGTGG + Intergenic
1122953434 14:105058892-105058914 AGAGGCACAAACACCATCTGAGG - Intronic
1202837121 14_GL000009v2_random:86537-86559 CGAGGTTCCAACAGCATGAGTGG + Intergenic
1123949212 15:25253702-25253724 GGAGGCGCCAAGAGCAAGTGAGG + Intergenic
1124434658 15:29637137-29637159 GAAGAGGCCAACAGCATCTGAGG - Intergenic
1124557872 15:30744784-30744806 GAAGGCTCCAGCAGCAACAGTGG - Intronic
1124673367 15:31660872-31660894 GAAGGCTCCAGCAGCAACAGTGG + Intronic
1127608631 15:60615502-60615524 GGGGGCTCCAGCAGCAGCCGGGG + Intronic
1128769057 15:70268330-70268352 GGAGGGTCCAAGGACATCTGGGG + Intergenic
1129784917 15:78303843-78303865 GGCGGCTGCAGCAGCACCTGGGG - Intergenic
1130738292 15:86572249-86572271 GGAGGCTGCAGCTGCACCTGTGG + Intronic
1131986152 15:98044374-98044396 GGAGCATCCCTCAGCATCTGGGG - Intergenic
1134689694 16:16183028-16183050 GGAGTCTCCAAGAGGACCTGTGG + Intronic
1137132665 16:36909072-36909094 GGAGACTTCAAGAGCATTTGAGG + Intergenic
1138679124 16:58672329-58672351 GGAGGCTGCAGCAGCAGCTCTGG + Intronic
1139507082 16:67404185-67404207 GGAGGAGCCAAGAGCATGTGGGG + Intronic
1143823690 17:9586644-9586666 GGAGGCATTAAAAGCATCTGAGG - Intronic
1144312055 17:14022948-14022970 GGAGGCTTCACCATAATCTGTGG + Intergenic
1144332704 17:14238371-14238393 GGAGGCTTCACCATAATCTGTGG - Intergenic
1144478887 17:15612678-15612700 GTGGGTTCCAACAGCATCTGGGG - Intronic
1144556306 17:16285850-16285872 GCAGGGTCCAACAACTTCTGGGG - Intronic
1144625252 17:16841089-16841111 GGAGGCACTCACAGCACCTGGGG - Intergenic
1144881177 17:18431632-18431654 GGAGGCACTCACAGCACCTGGGG + Intergenic
1144919417 17:18751054-18751076 GTGGGTTCCAACAGCATCTGGGG + Intronic
1145151055 17:20512754-20512776 GGAGGCACTCACAGCACCTGGGG - Intergenic
1145268227 17:21390591-21390613 GGAGGCTGCAGCAGCATTTCTGG + Intronic
1145981485 17:29014861-29014883 GGGGTCTCCACCAGCAGCTGAGG + Intronic
1146761416 17:35482454-35482476 GGTGGCTGCAGCAGCACCTGGGG - Intronic
1147579407 17:41619788-41619810 GGAGGCACTCACAGCACCTGGGG - Intronic
1148386405 17:47237940-47237962 GGTGGCTGCAGCAGCACCTGGGG + Intergenic
1152099924 17:78295099-78295121 GGAGACTCCAGCAGCATCGAAGG + Intergenic
1152773630 17:82186472-82186494 GGAGGCACCTAAAGCCTCTGCGG - Intronic
1153527169 18:6008445-6008467 GGTGGCTTCAACACCACCTGAGG + Intronic
1154531722 18:15352725-15352747 GCAGGCTCCAACAGTAAGTGAGG + Intergenic
1156969600 18:43139374-43139396 GGAGGCACCAAGAGCAAGTGAGG - Intergenic
1158112059 18:53951412-53951434 GGAAGCTCCAGCAGCTTCAGTGG - Intergenic
1160190115 18:76708573-76708595 GGGGGCTCCCGCAGCAGCTGAGG - Intergenic
1160584220 18:79903833-79903855 GGGGTCTCCATCAGCCTCTGTGG - Exonic
1162231460 19:9270531-9270553 GGCGGCTGCAACAGCACCTGGGG - Intergenic
1162315931 19:9937827-9937849 CGAGGCCCCACCAGCGTCTGGGG - Intergenic
1167688035 19:50968768-50968790 GGACGTTCCAGAAGCATCTGGGG - Exonic
1168559533 19:57371430-57371452 GGAAACCCCAACAGCATCTGTGG - Intronic
925202712 2:1981829-1981851 AGTGGCCTCAACAGCATCTGTGG + Intronic
925414801 2:3661916-3661938 GGATGCTCCCAGAGCCTCTGAGG - Intronic
925885673 2:8392220-8392242 GAAGACACCAACAGCATCTTTGG + Intergenic
926147095 2:10403191-10403213 GGAGGCTTCCAAAGCACCTGAGG - Intronic
929230113 2:39550414-39550436 GGAGACTGCAAGAGCAACTGGGG - Intergenic
930547110 2:52782338-52782360 GGAGGCTCCACCTTCATCAGTGG + Intergenic
931893740 2:66705060-66705082 GGAGGCTCCCACTACATGTGAGG - Intergenic
936491951 2:112979501-112979523 GGAGGCTCCTCCACCATCTCTGG - Intronic
937234998 2:120425373-120425395 GGGGCGTCCAAGAGCATCTGAGG - Intergenic
940875304 2:158892175-158892197 GGAGGCGCAAAAAGCATGTGGGG - Intergenic
948755362 2:240156526-240156548 GGAGCGTTCAACAGCATCTCCGG + Intergenic
1171307289 20:24117283-24117305 GGTGGCTCTCACAGCCTCTGAGG + Intergenic
1173228014 20:41173336-41173358 GGAGGCTCAGTCAGCATCTGTGG - Intronic
1176127326 20:63481875-63481897 GGAGGCAGCCACAGCCTCTGGGG + Intergenic
1176138245 20:63534413-63534435 GGAAGCACCAACAGCAACTGTGG - Intronic
1176765636 21:13015443-13015465 GCAGGCTCCAACAGTAAGTGAGG - Intergenic
1178533722 21:33395793-33395815 GGAGGCTCCCACAGAAGGTGGGG + Intergenic
1179718901 21:43304448-43304470 GGAGGCTCCAGCAGCAGACGCGG - Intergenic
1179922468 21:44514551-44514573 GGAAGCTGCAACACCTTCTGAGG + Intronic
1180248323 21:46563117-46563139 GGAGGCTCCAACAGCATCTGGGG + Intronic
1181145151 22:20840539-20840561 GGAGACTCCTGCAGCAGCTGAGG + Intronic
1181145153 22:20840560-20840582 GGAGACTCCTGCAGCAGCTGAGG + Intronic
1181162408 22:20966379-20966401 GGTGGCTCCCACAGCCACTGGGG - Intronic
1181311383 22:21946661-21946683 GGTGGCCCCAGCAGCCTCTGGGG - Intronic
1182620236 22:31614826-31614848 GCAGGCTCCAACAGGAAGTGTGG - Exonic
1183934905 22:41256563-41256585 GGAGGCTCACACAGCATCACAGG + Intronic
1184483307 22:44760842-44760864 AGAGGCACCATCAGCATCTGTGG - Intronic
1184553716 22:45220530-45220552 GAATGCTCCTTCAGCATCTGTGG - Intronic
1184655139 22:45937271-45937293 GAAGGCTCCAGGAGCATGTGTGG - Intronic
1184907661 22:47499709-47499731 GGAGGCTCAACCTGCCTCTGAGG - Intergenic
950535144 3:13574317-13574339 GGAGGTTCCCAGAGCAGCTGGGG - Intronic
950813021 3:15668078-15668100 GGAGGCTTCAACTCCATCTAAGG + Exonic
954131734 3:48564509-48564531 GGAGGCTACAACAGGAAGTGGGG + Intronic
954714085 3:52518508-52518530 GGAGGCAGCAACAGCATGAGTGG - Intronic
954967700 3:54625769-54625791 GGGGGCTCCTACTGCTTCTGAGG + Intronic
955768832 3:62370578-62370600 GGAAGCTGCACCAGCCTCTGTGG - Intronic
958195162 3:90235046-90235068 GGAAGCTGCAGCAGCATCCGAGG - Intergenic
959163332 3:102744836-102744858 GTAGTCTTCAACAGCATTTGGGG + Intergenic
959793882 3:110398242-110398264 GGAGGCTCTAACAGCTTGTTTGG - Intergenic
962824676 3:139089184-139089206 GGTGGCTGCAGCAGCACCTGGGG + Intronic
962904494 3:139789601-139789623 GGAGGATCAGACAGCACCTGAGG + Intergenic
964166128 3:153707272-153707294 GGAGGCTACAACTGAAACTGTGG + Intergenic
964357215 3:155861847-155861869 TGAGGCCCCACCAGCATTTGGGG - Intergenic
968461179 4:725844-725866 GGAGGCTCCGTCATCATCTGTGG - Intronic
969523708 4:7693483-7693505 TGGGGCACCCACAGCATCTGAGG - Intronic
970200090 4:13595523-13595545 GTAAGCTGCAATAGCATCTGGGG + Intronic
974080407 4:57206501-57206523 GTGGGCTCCAACAGCATTGGTGG + Intergenic
976870307 4:89784442-89784464 GGAAGCTCCAAAAGCACCAGTGG - Intronic
980865848 4:138553021-138553043 GGAGGCACCAAGAGCAAGTGAGG - Intergenic
983178942 4:164624087-164624109 GGAGGCATAAACAGCATCAGTGG - Intergenic
983752767 4:171298121-171298143 GGAGGCGCCAAGAGCAAGTGAGG - Intergenic
984011624 4:174378644-174378666 AGAGTCCCCACCAGCATCTGAGG + Intergenic
984802600 4:183728684-183728706 CGAGGTTCCAACAGCCTCGGTGG - Intergenic
985814601 5:2117273-2117295 GGGTGCTCCAACAGAAGCTGTGG + Intergenic
985884937 5:2670311-2670333 GGAGCCTCTAAGTGCATCTGCGG - Intergenic
990957703 5:61360165-61360187 GTAGGCTCCATCATCATCTGTGG - Intronic
993061022 5:83039320-83039342 GGAAACTCCACCAGCATTTGTGG - Intergenic
997394900 5:133551652-133551674 GGAGGAGCCAACAGTATCTTTGG + Intronic
997529792 5:134574938-134574960 TGATGCTCCAACAACATCTCAGG + Intronic
998452384 5:142244954-142244976 GGAAGCTCCAGGAGCATGTGTGG + Intergenic
1000341938 5:160284553-160284575 GGGGCCTCCCAGAGCATCTGTGG - Intronic
1002271195 5:178073610-178073632 CCAGGCTGGAACAGCATCTGAGG - Intergenic
1002536666 5:179879684-179879706 GGAGGCGCCAACCGCATCCCAGG - Exonic
1003157363 6:3607925-3607947 GGTGGCAGCAACAGCATCGGTGG + Intergenic
1006170006 6:32087186-32087208 GCAGGCTCCAACGGCAGGTGAGG + Intronic
1006718475 6:36135239-36135261 GGAGGCTCCTGCAGCCTCTTAGG - Intronic
1008033250 6:46720201-46720223 AGTGTCTCCAACAGCAGCTGTGG - Intronic
1009418897 6:63443447-63443469 GGAGGCACCAAGAGCAAGTGAGG + Intergenic
1013488242 6:110618579-110618601 TGAGGTCCCACCAGCATCTGGGG + Intronic
1017780419 6:157711347-157711369 TTAGGCCCCAACAGCATCTGCGG + Intronic
1017945684 6:159094693-159094715 GGAGGCACAAACAGCAGCTGGGG - Intergenic
1018170085 6:161137722-161137744 GGCGTCTCCAGGAGCATCTGAGG - Intronic
1018170091 6:161137761-161137783 GGAGTCTTCAGGAGCATCTGAGG - Intronic
1018170098 6:161137802-161137824 GGAGTCTTCAGGAGCATCTGAGG - Intronic
1018170105 6:161137843-161137865 GGAGTCTTCAGGAGCATCTGAGG - Intronic
1018170113 6:161137884-161137906 GGCGTCTCCAGGAGCATCTGAGG - Intronic
1018738762 6:166711170-166711192 GGAGGCTCCAGCTCCCTCTGTGG - Intronic
1020375426 7:7479048-7479070 GGAGGCGCCAAGAGCAAGTGAGG + Intronic
1020929603 7:14376209-14376231 CGAGGCACCCACAGCAGCTGTGG + Intronic
1021489064 7:21198574-21198596 AGATGGTCCAACAGCATCTCGGG - Intergenic
1023508757 7:40927718-40927740 GGAGGCTCCAAAAGGGTCAGTGG - Intergenic
1023874092 7:44277653-44277675 GGAGGCTCCAGCAGCCTCCCCGG - Intronic
1025738906 7:64180848-64180870 GGAGACTCCAACATCAGCTTGGG + Intronic
1028899428 7:96080359-96080381 GCAGGTTCCAACAGCAAGTGTGG + Exonic
1033298750 7:140166248-140166270 AAAGGCTCCTTCAGCATCTGTGG - Intronic
1033521564 7:142166199-142166221 TGATGATCCAACAGCCTCTGAGG + Intronic
1034047946 7:147949719-147949741 GGAGACCCCAACAGCTTCTCTGG - Intronic
1034479900 7:151311520-151311542 GGCAGCTCCAGCAGCATGTGTGG - Intergenic
1034542784 7:151769722-151769744 GGATGCTGCAGCCGCATCTGGGG + Intronic
1035578846 8:727469-727491 GGCAGCTCCAACTTCATCTGAGG + Intronic
1036508778 8:9381397-9381419 TGAGGTTCCAACAGCATTTGGGG - Intergenic
1036949515 8:13127874-13127896 GGAGGTGCCAAAGGCATCTGAGG + Intronic
1038512034 8:28147100-28147122 GGAGGCTGCTACAGAATCTGTGG - Intronic
1045264657 8:100608965-100608987 GGAGGCTCCCAGAGCAGCTCAGG - Intronic
1045271195 8:100663107-100663129 GGAGGCTCCAAAAGGAGCGGGGG + Intronic
1045585013 8:103524732-103524754 GCAGGCTCCAGCATCCTCTGAGG - Intronic
1047124656 8:121947890-121947912 GGAGGCGCCAAGAGCAAGTGGGG - Intergenic
1052764976 9:32631827-32631849 GGAGGATTCAAGAGCAACTGAGG - Exonic
1057028984 9:91759171-91759193 GTAGGATCCTCCAGCATCTGTGG + Intronic
1059328640 9:113520482-113520504 GGAGGAGCCACCAGCAACTGGGG - Intronic
1060689346 9:125642830-125642852 GGAGGTCCCACCAGCATTTGGGG + Intronic
1061212152 9:129199979-129200001 GGAGGCTCCTACAGATTGTGCGG + Intergenic
1186190254 X:7061058-7061080 CCAGGCTCCATCAGCATCTCAGG - Intronic
1186388838 X:9137674-9137696 GGAGGCCTCCACAGCTTCTGAGG - Intronic
1186667340 X:11731222-11731244 GGAGGCTGAAGCAGCCTCTGAGG + Intergenic
1187398734 X:18940701-18940723 GGAGGCTGCTACAGCAGATGTGG + Intronic
1190124377 X:47690397-47690419 TCAGGCTCCTGCAGCATCTGCGG - Intergenic
1190700999 X:52989794-52989816 GCAGGCTCCAACAGAGCCTGGGG - Intronic
1192470998 X:71398628-71398650 GGAGGATTCAAGAGCAACTGAGG + Exonic
1192639433 X:72847985-72848007 GGAGGCTGGACCAGCAACTGTGG + Intronic
1192642278 X:72872820-72872842 GGAGGCTGGACCAGCAACTGTGG - Intronic
1193100022 X:77599761-77599783 GGAGGTTTCATCAGAATCTGAGG + Exonic
1199443758 X:147897482-147897504 GGAGGCTCCGAGAGCAAATGAGG + Intergenic
1200801452 Y:7390785-7390807 GGAGGCTTCATCTGTATCTGTGG + Intergenic
1201964145 Y:19713261-19713283 GGAGACGCCAAAAGCAACTGCGG + Intronic
1202046097 Y:20738457-20738479 GGAGGCTCTCACTGCAGCTGTGG - Intergenic