ID: 1180248398

View in Genome Browser
Species Human (GRCh38)
Location 21:46563490-46563512
Sequence GACAGACATGTGCCTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180248396_1180248398 -7 Left 1180248396 21:46563474-46563496 CCTGGCCAAGAACTAGGACAGAC 0: 1
1: 0
2: 2
3: 8
4: 98
Right 1180248398 21:46563490-46563512 GACAGACATGTGCCTCCTGCAGG 0: 1
1: 0
2: 2
3: 12
4: 169
1180248394_1180248398 8 Left 1180248394 21:46563459-46563481 CCTCATGGTCAGGTTCCTGGCCA 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1180248398 21:46563490-46563512 GACAGACATGTGCCTCCTGCAGG 0: 1
1: 0
2: 2
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180248398 Original CRISPR GACAGACATGTGCCTCCTGC AGG Intronic
900185297 1:1330583-1330605 GGCACACAGGTGGCTCCTGCTGG - Intergenic
900930682 1:5735098-5735120 GACAGGCCTGTGCCCGCTGCAGG + Intergenic
903137771 1:21320662-21320684 AACAGACACGTGCGTCCTTCAGG - Intronic
903191626 1:21659649-21659671 GGCAGACATGTAACTCTTGCAGG - Intronic
904818713 1:33226071-33226093 GTCAGGTATGTGCCTCCTGGGGG - Intergenic
905240887 1:36580765-36580787 GGGAGACATGTGGCTGCTGCAGG + Intergenic
905923200 1:41732622-41732644 GAGAGACATGAGGCTCCAGCTGG - Intronic
910408062 1:86911466-86911488 GACAAACAAGTGCCTCCTTAAGG + Intronic
910761919 1:90741422-90741444 GACGTGTATGTGCCTCCTGCTGG + Intergenic
911299378 1:96153635-96153657 GACAAAAATGTGTCTCCAGCAGG + Intergenic
912132280 1:106618313-106618335 CACAGACATGCTCCTACTGCAGG - Intergenic
912332997 1:108836227-108836249 CAAAGACTTGTGACTCCTGCAGG + Intronic
916464758 1:165062727-165062749 GGCAGTCGTGTGCCTGCTGCTGG + Intergenic
919893276 1:201991755-201991777 GACAGAAATGTGTGTCCTGGTGG + Intronic
920398052 1:205660690-205660712 GACAGACATGCTCCTCCATCTGG + Intronic
920836724 1:209517906-209517928 GACAGAAAAGTCACTCCTGCTGG - Intergenic
922222844 1:223621607-223621629 GCCACACATGAGCCTCCTGTAGG - Intronic
923143850 1:231184449-231184471 GAAAGCCATTTGCCTACTGCAGG - Intronic
924705755 1:246500630-246500652 GATAGCCATGTGGCTTCTGCTGG - Intronic
1066255899 10:33678644-33678666 CACATACATATACCTCCTGCTGG + Intergenic
1070786895 10:79167110-79167132 GCCACACCTGTGCCTCCTGGAGG + Intronic
1073121658 10:101125674-101125696 GACAGACATGTCCCTGCTGTAGG - Intronic
1073242273 10:102066383-102066405 GGCCTACAGGTGCCTCCTGCAGG - Exonic
1075590825 10:123690158-123690180 AACAGACATTTGCTTCCTGGTGG + Exonic
1075773861 10:124966192-124966214 GACAGGGATGTGCTTCCAGCTGG - Intronic
1076893868 10:133299310-133299332 GAGAGACATGTCCTTCCAGCAGG + Intronic
1078084083 11:8223437-8223459 GACAGACATGTGCTGCAGGCAGG - Intergenic
1079912561 11:26329682-26329704 GATACATATTTGCCTCCTGCTGG + Intronic
1080298275 11:30754979-30755001 GAGAGCCAAGTGCTTCCTGCTGG - Intergenic
1083132141 11:60634344-60634366 TACCCACAGGTGCCTCCTGCTGG + Intergenic
1083345976 11:61992364-61992386 GACAGACACGTACCTCCTGATGG - Intergenic
1085055905 11:73403672-73403694 GACAGTCATGTGCCTCTGGTAGG - Intronic
1085276679 11:75304696-75304718 GACTGACATGTGCATTATGCAGG - Intronic
1085281707 11:75335241-75335263 GACAGACTTGGACCTACTGCAGG - Intronic
1086018343 11:82194821-82194843 TACTGACATGTGGCTTCTGCGGG - Intergenic
1089604108 11:119631759-119631781 CAATGACATGTGACTCCTGCTGG + Intronic
1089697562 11:120225530-120225552 AACAGACACCTCCCTCCTGCTGG - Intronic
1090900453 11:131026326-131026348 GACAGACATGTGCCCAATTCTGG - Intergenic
1091832458 12:3559707-3559729 GACAGACATCTGCCTGGGGCAGG - Intronic
1094524526 12:31222877-31222899 GCCAGGCATCTGCCACCTGCCGG + Intergenic
1095161429 12:38921260-38921282 GGTAGGCATGTGCCACCTGCTGG - Intergenic
1096706373 12:53424834-53424856 TACAGCCATCTGCCTCCTCCAGG + Exonic
1096979196 12:55718719-55718741 GCCAGATGTGTTCCTCCTGCTGG + Intronic
1099334744 12:81340647-81340669 GACAGGTATGTGCATCCTGTGGG - Intronic
1101575847 12:105995659-105995681 AACAGGGATGAGCCTCCTGCAGG - Intergenic
1102633097 12:114299369-114299391 GACAATTAAGTGCCTCCTGCAGG + Intergenic
1103275110 12:119704793-119704815 CCCACACATGTGCCTTCTGCTGG + Intronic
1104586798 12:130054061-130054083 GGCAGACAGCTGCCTCTTGCCGG + Intergenic
1107601323 13:42015823-42015845 GACAGCCAGGAGCCTCCTGGGGG + Intergenic
1110255631 13:73430806-73430828 AAAAGACATGTAACTCCTGCAGG + Intergenic
1110598620 13:77346094-77346116 TACAGACATGTGCCACCAGATGG + Intergenic
1111224189 13:85247953-85247975 GAAAGACTTGTTCCTCATGCAGG - Intergenic
1113982623 13:114289017-114289039 GGCAGACACGTGGCTCCTGCCGG + Intronic
1114687212 14:24544582-24544604 GACATACATGTGCCTTCAGAGGG - Intergenic
1119478900 14:74947708-74947730 AACATTCAAGTGCCTCCTGCGGG + Intronic
1119759016 14:77138668-77138690 GACAGAGCTTAGCCTCCTGCTGG + Intronic
1119787589 14:77324922-77324944 GTAAGAGATGTGCCTCCTCCAGG + Intronic
1120722876 14:87906758-87906780 GACACACAGGGGCCTCCTGTTGG - Intronic
1121330707 14:93047815-93047837 GCCCGACATCTGCTTCCTGCAGG + Intronic
1122264163 14:100538976-100538998 GACCGACGTGGGCTTCCTGCGGG - Exonic
1125474678 15:40039021-40039043 TCGAGACCTGTGCCTCCTGCAGG - Intronic
1126158534 15:45587430-45587452 GACACTCATGTCCCTCCAGCTGG - Exonic
1128141158 15:65301692-65301714 GACAGACATGTTGCCCATGCTGG - Intergenic
1128810845 15:70571424-70571446 GGTTGACATGTGCCTCCTGCAGG - Intergenic
1129477761 15:75797552-75797574 GACAGAGATGAGGCTCCTGGGGG - Intergenic
1129835828 15:78704818-78704840 GACAGAGATGAGGCTCCTGGGGG - Intronic
1132018570 15:98340280-98340302 GACAGAGATTTGCCTTCTGGTGG + Intergenic
1133789196 16:8996155-8996177 GACAGGCATGTGACTCAGGCTGG + Intergenic
1136471325 16:30482644-30482666 CACAGACATGGGCCTATTGCGGG - Intronic
1139312227 16:66037296-66037318 GACAGTTATGTGTCTGCTGCTGG - Intergenic
1140296511 16:73714321-73714343 GTCTGACATCTGCCCCCTGCTGG - Intergenic
1140423448 16:74840555-74840577 GCCAGACATTCGTCTCCTGCTGG + Intergenic
1140610171 16:76589099-76589121 GACAGACAAGTGCCTTCTGAAGG + Intronic
1141795518 16:86270783-86270805 GACAGGGATGAGCCTCCTGGGGG + Intergenic
1143360016 17:6361928-6361950 GATAGACATGTGACTCAGGCAGG - Intergenic
1144336012 17:14269572-14269594 GGCAGTCATGTTCCTCCTGGAGG + Intergenic
1145238103 17:21223213-21223235 GGCAGACATCTGCCTTCAGCCGG - Intergenic
1150244901 17:63667037-63667059 GACAGAGAGGTGCCTGCTTCTGG - Exonic
1152406753 17:80102176-80102198 CCCAGCCATGTGCGTCCTGCAGG - Intergenic
1152749420 17:82055774-82055796 GGCTGCCAAGTGCCTCCTGCTGG + Exonic
1152785551 17:82246145-82246167 GACCGACAGGTGCCACCTGGGGG + Intronic
1156315116 18:35962432-35962454 GGCATGCATGTGCCTCCTGATGG - Intergenic
1158517515 18:58143022-58143044 AGCAGACAGGTGCCTGCTGCAGG + Intronic
1163862068 19:19747834-19747856 GACCCGCCTGTGCCTCCTGCTGG - Intergenic
1164444293 19:28303884-28303906 CACAGAGCTGTGCCTCCTGAGGG - Intergenic
1164461956 19:28456524-28456546 CACAGGCATGAGCCACCTGCTGG - Intergenic
1164822365 19:31260079-31260101 GGCAGACATGGGCCTCCTGCAGG + Intergenic
1165140051 19:33693814-33693836 GGCAGACAGGAGCCTCCTGATGG - Intronic
1165315484 19:35052862-35052884 GAGAGTCATGGGCCTCCAGCTGG + Intronic
1166321867 19:42023673-42023695 GCCAGACACCTGCCTCTTGCTGG + Intronic
1166773830 19:45300471-45300493 TACAGATGTTTGCCTCCTGCTGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
1168349406 19:55667485-55667507 CACAGACAAGTGCCTGCTGGTGG - Intronic
926494083 2:13562133-13562155 GACAGAATTGTGTCTGCTGCAGG + Intergenic
927720458 2:25378820-25378842 CACAGACATGTGATTCATGCAGG - Intronic
929779370 2:44947943-44947965 AACACACATGTCCTTCCTGCAGG - Intergenic
933945375 2:87281762-87281784 GACAAACATCTGGCTCCTGTTGG + Intergenic
934567270 2:95347618-95347640 GACAGAAATGTGGCGCCTGCGGG - Intronic
935078162 2:99766252-99766274 GAAAGGCATGTGCCTTCGGCAGG - Intronic
935193109 2:100794056-100794078 GACACAGCTGTGACTCCTGCCGG - Intergenic
935811818 2:106805917-106805939 GCCAGTGATGTGCCTCCTGGTGG + Exonic
936334834 2:111579829-111579851 GACAAACATCTGGCTCCTGTTGG - Intergenic
945272964 2:207960295-207960317 GACAGAAATCTGCTTCCTGAAGG - Intronic
945807442 2:214507765-214507787 GACAGTCATGAGCCTCAAGCAGG + Intronic
947827719 2:233117695-233117717 ATGAGACATCTGCCTCCTGCCGG + Intronic
1170029072 20:11925286-11925308 GACAGTAATGGTCCTCCTGCTGG + Exonic
1170630276 20:18058990-18059012 GTCAGACGTGTGCCAGCTGCCGG + Intronic
1175493963 20:59400086-59400108 GACAGAAATGTCCCCCTTGCCGG + Intergenic
1176341515 21:5701717-5701739 TACAGGCATGAGCCTCATGCCGG - Intergenic
1176473769 21:7133870-7133892 TACAGGCATGAGCCTCATGCCGG - Intergenic
1176503312 21:7622739-7622761 TACAGGCATGAGCCTCATGCCGG + Intergenic
1176853218 21:13937298-13937320 GAAAGACGTGTGGATCCTGCTGG - Intergenic
1178456442 21:32757822-32757844 GACAGTCATGTCCTTCCTACTGG - Intronic
1179898709 21:44377814-44377836 GACAGTCATCTGCCTGCAGCAGG - Intronic
1179994153 21:44966276-44966298 GGCAGACCTGTGCCCCCTGGGGG - Intronic
1180248398 21:46563490-46563512 GACAGACATGTGCCTCCTGCAGG + Intronic
1182557144 22:31135362-31135384 GACATACATGTACCTCCTCCTGG + Exonic
1183504948 22:38203552-38203574 GACAAACAGGTGCTTTCTGCAGG - Intronic
1184584897 22:45441349-45441371 GAGATAGATGTGCCACCTGCTGG - Intergenic
1184919598 22:47596410-47596432 GTCAGACATGGGTCTTCTGCGGG - Intergenic
1203240781 22_KI270733v1_random:16183-16205 TACAGGCATGAGCCTCATGCCGG - Intergenic
949492171 3:4599774-4599796 ATCACACATGTGCCTCCTGCTGG - Intronic
950068368 3:10131884-10131906 GACAGACATGTCCATCCTGGTGG + Intergenic
952817122 3:37455220-37455242 GACTGACATGTCCCTCAAGCAGG - Intronic
954453702 3:50585617-50585639 GCCAGACATGGGCCTCATGCTGG + Intergenic
955219509 3:57012019-57012041 GAGGGACATGTGCCTTCTGAGGG + Intronic
959674916 3:109023858-109023880 GAGTGACAAGTGCCACCTGCTGG - Intronic
961589109 3:127962178-127962200 TACAGGCATGTCCCTCCTTCCGG + Intronic
963224058 3:142842949-142842971 CACACACAAGTGACTCCTGCAGG + Exonic
969487442 4:7480187-7480209 CACAGACATGTCCCTGCTTCAGG - Intronic
972075145 4:35078755-35078777 GTAGGACATGGGCCTCCTGCTGG - Intergenic
979366634 4:119832716-119832738 GACAGACAGGTGACTACTGTAGG + Intergenic
984097443 4:175449759-175449781 AACACACATGCGCCTGCTGCAGG + Intergenic
986213669 5:5698293-5698315 GACAAAAATGTGTCTCCTGGGGG - Intergenic
992089106 5:73302135-73302157 GACAGTCATTTGCCTCGTGCTGG - Intergenic
997339414 5:133130963-133130985 GTCACATAAGTGCCTCCTGCGGG - Intergenic
998861297 5:146447015-146447037 GACAGACACGTGGCTACCGCAGG + Intergenic
998910278 5:146952326-146952348 GACAGACAACAGCATCCTGCTGG + Intronic
1002569889 5:180134320-180134342 GACAGACCTGTGCGTTCTCCAGG + Intronic
1005362353 6:25042744-25042766 TGCAGACATGGGCCACCTGCAGG - Intergenic
1019075360 6:169382919-169382941 GACAGACAGGGGCCTTCTGGAGG + Intergenic
1020192587 7:6011494-6011516 GACAGGCCTGTTTCTCCTGCTGG - Intronic
1020555544 7:9664996-9665018 GACAAAAATGTGTCTCCTGGGGG + Intergenic
1021175885 7:17449459-17449481 GAGAGGTATGTGCCTGCTGCTGG + Intergenic
1022318818 7:29268716-29268738 GAGAGAGCTGTGCCTCGTGCAGG - Intronic
1022723082 7:32957850-32957872 GACAGGCCTTTCCCTCCTGCCGG + Intronic
1025149971 7:56540161-56540183 GACCTGCCTGTGCCTCCTGCTGG + Intergenic
1026845478 7:73696790-73696812 GCCTCTCATGTGCCTCCTGCAGG + Intronic
1029283034 7:99449001-99449023 GGCAGAGATGTGCTCCCTGCTGG + Intronic
1029716671 7:102331936-102331958 GACAGGCCTGTTGCTCCTGCTGG + Intergenic
1033344906 7:140519097-140519119 GCCATATCTGTGCCTCCTGCAGG - Intronic
1033544092 7:142384402-142384424 GGCAGCCCTGTGCCTCCTGGGGG + Intergenic
1034910225 7:154990452-154990474 GACAGACTCCTGCTTCCTGCCGG - Intronic
1037681479 8:21101135-21101157 CAGAGACATGTGCATTCTGCAGG + Intergenic
1039409464 8:37340558-37340580 GACACACATCTCCCACCTGCTGG - Intergenic
1043525953 8:81096834-81096856 GACAGCCTTGTGCCCCCAGCAGG - Intronic
1045030446 8:98130205-98130227 GACGAACCGGTGCCTCCTGCAGG + Exonic
1046952301 8:120030245-120030267 GAAGGACATTTGACTCCTGCAGG - Intronic
1047165383 8:122432621-122432643 GACAGCAAAGTGCCTCATGCTGG + Intergenic
1047286377 8:123490719-123490741 GAAAGACATGTACCTCCTACTGG - Intergenic
1047674409 8:127184487-127184509 AAAAGACATGTGCCACCTGAGGG - Intergenic
1048737117 8:137514206-137514228 GACAGACATGTGACTCGGGTGGG + Intergenic
1048876982 8:138844486-138844508 TAGATACATGTGCCTGCTGCTGG + Intronic
1050820690 9:9875942-9875964 GAGAGACATATGACTACTGCAGG + Intronic
1050910796 9:11067088-11067110 GACAGAGCCGTGCCTACTGCAGG + Intergenic
1053668891 9:40340071-40340093 GGAAGACATTTGCCTCCTTCTGG + Intergenic
1053918686 9:42966343-42966365 GGAAGACATTTGCCTCCTTCTGG + Intergenic
1054380026 9:64480107-64480129 GGAAGACATTTGCCTCCTTCTGG + Intergenic
1054515720 9:66036223-66036245 GGAAGACATTTGCCTCCTTCTGG - Intergenic
1056718407 9:89053106-89053128 GACAGCCCTGTGGCTCCTTCAGG - Intronic
1057579045 9:96269394-96269416 GAAACACTTCTGCCTCCTGCAGG - Intronic
1058498775 9:105589842-105589864 GACAGACATATTCCTGCCGCAGG - Intronic
1059284496 9:113161225-113161247 GACAGATTTGTGCAGCCTGCTGG + Intronic
1059459532 9:114421017-114421039 GACATGCATGTGCCACCTGGTGG + Intronic
1060270273 9:122135188-122135210 GACTGACAAGTGCCCCCAGCAGG - Intergenic
1061081287 9:128371910-128371932 AACAGACCTGAGCCTCCTTCAGG + Intronic
1061159659 9:128885972-128885994 GTCACACATGTGCCTGCTGACGG + Intronic
1188243423 X:27814842-27814864 GACAGACATGTGCTTCATGCAGG - Intronic
1189616599 X:42790114-42790136 GACAAAAATGTGCCTCCAGGGGG + Intergenic
1189971158 X:46419680-46419702 GCCAGACCTGTACCTCTTGCTGG - Intergenic
1192436822 X:71148288-71148310 GACAGACAGATGCATGCTGCAGG - Intronic
1198332267 X:135632861-135632883 GACAGGCATATGTCTACTGCTGG - Intergenic
1198333621 X:135644970-135644992 GACAGGCATGTGTTTGCTGCTGG + Intergenic
1198383052 X:136102471-136102493 GACAGATATCTATCTCCTGCTGG - Intergenic