ID: 1180253083

View in Genome Browser
Species Human (GRCh38)
Location 21:46602599-46602621
Sequence CTGTCTAAGAGGCCGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180253083_1180253095 15 Left 1180253083 21:46602599-46602621 CCTTCCACCGGCCTCTTAGACAG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1180253095 21:46602637-46602659 CTCTGTCCGTGTGGGCCACGGGG 0: 1
1: 0
2: 0
3: 8
4: 106
1180253083_1180253091 7 Left 1180253083 21:46602599-46602621 CCTTCCACCGGCCTCTTAGACAG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1180253091 21:46602629-46602651 CCTGCCTTCTCTGTCCGTGTGGG 0: 1
1: 0
2: 2
3: 27
4: 230
1180253083_1180253094 14 Left 1180253083 21:46602599-46602621 CCTTCCACCGGCCTCTTAGACAG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1180253094 21:46602636-46602658 TCTCTGTCCGTGTGGGCCACGGG 0: 1
1: 0
2: 1
3: 10
4: 146
1180253083_1180253093 13 Left 1180253083 21:46602599-46602621 CCTTCCACCGGCCTCTTAGACAG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1180253093 21:46602635-46602657 TTCTCTGTCCGTGTGGGCCACGG 0: 1
1: 0
2: 1
3: 6
4: 118
1180253083_1180253089 6 Left 1180253083 21:46602599-46602621 CCTTCCACCGGCCTCTTAGACAG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1180253089 21:46602628-46602650 GCCTGCCTTCTCTGTCCGTGTGG 0: 1
1: 0
2: 2
3: 11
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180253083 Original CRISPR CTGTCTAAGAGGCCGGTGGA AGG (reversed) Intronic
905207216 1:36349787-36349809 CTGTCTAAGAGGCCTGGGAAAGG + Intronic
906101897 1:43269319-43269341 CTGTGTAAGGGGCCCATGGAGGG - Intronic
909498861 1:76310863-76310885 CTGTCAAGGAGTCAGGTGGAAGG - Intronic
924665300 1:246064757-246064779 CGGTCTAGAAGGCCGGGGGATGG - Intronic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1072323428 10:94273049-94273071 CTGTCAAGGAGGTGGGTGGAGGG - Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1075583382 10:123639367-123639389 CTGTCTAAGAAGCCTGTGTTAGG + Intergenic
1079357757 11:19743973-19743995 CTGTATCTGAGGCCAGTGGAGGG - Intronic
1079941054 11:26681131-26681153 ATGTCTTAGAGGCTGGTGCAGGG + Exonic
1079941183 11:26682587-26682609 ATGTCTTAGAGGCTGGTGCAGGG + Intronic
1080465742 11:32495595-32495617 CAGTCTAAGAAGCACGTGGATGG - Intergenic
1080908089 11:36566911-36566933 CTGTCAAGGAGGCAGGTGCAAGG - Intronic
1080932292 11:36824542-36824564 CTGTCAAAGAGGCCATTGGGAGG - Intergenic
1083708123 11:64530557-64530579 CCTTCTAAGAGGGAGGTGGAGGG + Intergenic
1084149833 11:67282927-67282949 CTGTCTCAGAGGCCAGAGTAGGG - Intronic
1092974301 12:13729489-13729511 CAGTCTTGGAGGCGGGTGGAAGG + Intronic
1097724397 12:63058334-63058356 ATGTCTAAAAGGCTGGTGGGAGG + Intergenic
1101655411 12:106715979-106716001 ATGTCTGAGAAGCAGGTGGATGG + Intronic
1103328988 12:120140791-120140813 CTGACTCAGAGGGCGGGGGAGGG - Intronic
1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG + Intergenic
1106396267 13:29383849-29383871 CTATGTAAGTGGCCTGTGGATGG - Intronic
1106562764 13:30860963-30860985 TTGTCTAAGAGGCTTGTGCAAGG + Intergenic
1112705040 13:102059187-102059209 ATGTCTAGGAGGCAAGTGGAAGG + Intronic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113733524 13:112658995-112659017 CTGCCTAAGAGGCCTGGGAAGGG - Intronic
1118081028 14:62361203-62361225 CTGTTTAAGAGGCTGTGGGAGGG + Intergenic
1119141449 14:72271074-72271096 GTGTCTGAGAGGCCAGAGGAAGG + Intronic
1119726485 14:76924716-76924738 CTGCCTTAGAGGCTGGGGGATGG + Intergenic
1120855538 14:89208873-89208895 ATGTTTAAGAGACAGGTGGAGGG - Intronic
1121568156 14:94925996-94926018 GTGTCTATGAGGCTGTTGGATGG + Intergenic
1122742589 14:103880831-103880853 CTGTCTCAGAGGTTGGGGGAAGG - Intergenic
1126004468 15:44243178-44243200 ATGTGTAGGAGGCCGATGGAGGG - Intergenic
1128381936 15:67119555-67119577 CTGTCTATGAAGCAGATGGATGG + Intronic
1129897150 15:79117004-79117026 CTGCTGAAGAGGCAGGTGGAAGG + Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135988625 16:27203421-27203443 CTGTTTAAAAGGCCGGGGGATGG - Intergenic
1136578543 16:31138807-31138829 CTGACTCAGAGGCCGGAGGAGGG + Intergenic
1137718278 16:50612194-50612216 CTGCCTGAGAGGCCGGAGGGAGG - Intronic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1141995647 16:87635033-87635055 CTGTCCCAGAGTCCAGTGGAGGG - Intronic
1142017921 16:87761247-87761269 CTGCCTCTGAGGCCGGTGGGTGG + Intronic
1145005720 17:19336626-19336648 CAGTCCCAGAGGCCGGTGGCTGG + Exonic
1148679975 17:49468061-49468083 CTGCCTAAGAGGCCTGGGGCAGG - Intronic
1149226771 17:54480625-54480647 CTGTCTAAGAGAGCTGTGCAGGG + Intergenic
1151174150 17:72273427-72273449 CTGGCTCAGAGGCCTGAGGATGG - Intergenic
1152167947 17:78723194-78723216 GTGGGTAAGAGGCTGGTGGATGG - Intronic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156816522 18:41317801-41317823 CTGTCTAAATGCCAGGTGGAAGG - Intergenic
1160346311 18:78135187-78135209 GTGCATAAGAGGCCAGTGGAAGG - Intergenic
1160494742 18:79366268-79366290 CTCTCTCAGAGCCCGCTGGACGG + Intronic
1160705200 19:526313-526335 CCGTTTAAGAGGGCGGTGGGGGG - Intergenic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
1165857717 19:38889913-38889935 TTGTCATAGAGGCCGGTGGATGG + Exonic
926484266 2:13435377-13435399 CTATCTATGTGGCCTGTGGATGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932807048 2:74793295-74793317 CTGTCTAACAGGAGGGTGGGTGG + Intergenic
933235502 2:79859736-79859758 CTGTTTCAGAGGCTGGTGAAGGG + Intronic
937829441 2:126403439-126403461 TTGTCTAAGAGGCCTGTGGATGG - Intergenic
938065988 2:128282393-128282415 CTGTCCAGGAGGCCAGAGGAAGG - Intronic
938764373 2:134450584-134450606 CAGTCTAAGAGGAGGGTGGGGGG + Exonic
942307798 2:174625573-174625595 CTGCCTCATAGGCTGGTGGAGGG + Intronic
945990012 2:216388271-216388293 CTGACTAACAGGCAGGTGGGAGG - Intergenic
948174074 2:235929268-235929290 CTTACTAAGAGGCAGGTGGCAGG + Intronic
948965129 2:241373537-241373559 CTGGCTAAGAGACTGCTGGAAGG + Intronic
1168925169 20:1573453-1573475 CTTTCTAAGAGGACGGCAGAAGG - Intronic
1168929046 20:1606481-1606503 CTTTCTAAGAGGACGGCAGAAGG - Intronic
1172035948 20:32010791-32010813 CTGTCTGAGAGGCTGCAGGAGGG - Intronic
1180253083 21:46602599-46602621 CTGTCTAAGAGGCCGGTGGAAGG - Intronic
1184520607 22:44991726-44991748 CTGGCTAGCAGGCCAGTGGAGGG - Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
953931206 3:47006702-47006724 CTGTCTAGGAAGGCGATGGAAGG - Intronic
955903229 3:63779405-63779427 CTGTGTCTGAGGCCGGGGGAGGG - Intergenic
956928891 3:74020226-74020248 CTGCCAAAGAGGTGGGTGGACGG + Intergenic
961214786 3:125150849-125150871 CTGTCTTCGAGGCCCTTGGAAGG - Intronic
966748021 3:183296821-183296843 GAGTCTAAGAGGCCGCCGGAGGG + Intronic
966938808 3:184732126-184732148 CTGTCTGAAAAGCCAGTGGAAGG - Intergenic
969117495 4:4880414-4880436 CTCTGTCAGAGGACGGTGGAGGG - Intergenic
970191945 4:13525701-13525723 CTTCATAAGAGGCCAGTGGAAGG - Intergenic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
978766728 4:112412177-112412199 CTGGCAAAGAGGCGGGTGGAAGG - Intronic
990582085 5:57174533-57174555 GTGTGCAAGAGGCCGGGGGAAGG - Intronic
996613692 5:125414275-125414297 CTGTCTAAGATGCCAGTCGAAGG - Intergenic
1002769599 6:279791-279813 CTGTCTGTGAGGCCGGAGGCTGG + Intergenic
1003094349 6:3130982-3131004 CTGTCCTAGAGGCCGCGGGAGGG - Intronic
1006437068 6:34031216-34031238 CGGGCTAAGAGGCAGGTGGGTGG - Intronic
1007854254 6:44838416-44838438 CTGTGTAAGAGGGCAGTAGAGGG + Intronic
1011030585 6:82918734-82918756 CTATCTAGGAGGCCTGAGGAAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1018840084 6:167510162-167510184 CTGTCTAAGGGGCCTGTGATTGG + Intergenic
1019064864 6:169288291-169288313 CTTTATGAGAGGCAGGTGGAAGG - Intergenic
1024743082 7:52376238-52376260 CTGAGTAAGAGGCGTGTGGATGG + Intergenic
1029194754 7:98797428-98797450 CTGTGTCAGAGGCCGACGGAGGG + Intergenic
1031468574 7:122143706-122143728 CTGGCTGAGGGGGCGGTGGATGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033118140 7:138644592-138644614 CTGTCTGAGAGGCAGGGCGATGG - Intronic
1034932333 7:155172360-155172382 TTGGTTAAGAGGCCAGTGGAGGG - Intergenic
1037069742 8:14629562-14629584 GTGGCTAAGAGGACAGTGGATGG - Intronic
1041249176 8:55918235-55918257 CTGTCTCAGAGGCCTGTGGGAGG - Intronic
1050382870 9:5049159-5049181 CTCTTTAAGAGGCTGGTGTATGG - Intronic
1060523931 9:124309948-124309970 CTTTTGAAGAGGCCGGTGGCGGG + Intronic
1062190334 9:135244768-135244790 CTGGCAAAGAGGCAGGTGGGAGG + Intergenic
1186700696 X:12086993-12087015 CTGTCAGAGAGGCCTGTGAAAGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic