ID: 1180260239

View in Genome Browser
Species Human (GRCh38)
Location 21:46663420-46663442
Sequence GACCCAGTCCCTGTCCATAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180260235_1180260239 26 Left 1180260235 21:46663371-46663393 CCTGTCTTGCAGCACCACACACT 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1180260239 21:46663420-46663442 GACCCAGTCCCTGTCCATACAGG 0: 1
1: 0
2: 0
3: 5
4: 139
1180260237_1180260239 12 Left 1180260237 21:46663385-46663407 CCACACACTGGAAGCAGACGCTG 0: 1
1: 1
2: 3
3: 13
4: 156
Right 1180260239 21:46663420-46663442 GACCCAGTCCCTGTCCATACAGG 0: 1
1: 0
2: 0
3: 5
4: 139
1180260234_1180260239 27 Left 1180260234 21:46663370-46663392 CCCTGTCTTGCAGCACCACACAC 0: 1
1: 0
2: 0
3: 23
4: 181
Right 1180260239 21:46663420-46663442 GACCCAGTCCCTGTCCATACAGG 0: 1
1: 0
2: 0
3: 5
4: 139
1180260233_1180260239 28 Left 1180260233 21:46663369-46663391 CCCCTGTCTTGCAGCACCACACA 0: 1
1: 0
2: 0
3: 26
4: 263
Right 1180260239 21:46663420-46663442 GACCCAGTCCCTGTCCATACAGG 0: 1
1: 0
2: 0
3: 5
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180260239 Original CRISPR GACCCAGTCCCTGTCCATAC AGG Exonic
902134485 1:14293046-14293068 GAGCCAGGCCCTGTGCAAACTGG + Intergenic
902719929 1:18297134-18297156 GACCTAGTCCCTGTCCTCATGGG - Intronic
905768362 1:40621862-40621884 GCCCAAGGCCCTGTCCTTACTGG + Exonic
912448981 1:109758200-109758222 GGCCCAGGCCCTGGCCATCCTGG + Intronic
916192548 1:162193368-162193390 GTCCCAGTCCCTGGGCATAAAGG + Intronic
919814372 1:201428359-201428381 CCCCCAGTCCCTGGACATACAGG - Intronic
920310221 1:205044144-205044166 GCCCCAGCCCCTTTCCTTACTGG - Intronic
923621573 1:235583737-235583759 TACCTTGACCCTGTCCATACAGG + Exonic
924884687 1:248201873-248201895 AACAAAGTCCCTGTGCATACAGG - Intergenic
1062909925 10:1205788-1205810 TACCCAGTCTCGGTCCATCCCGG - Intronic
1062982744 10:1738836-1738858 GTTCCAGTTCCTGTCTATACTGG - Intergenic
1063071604 10:2671902-2671924 GTCCCCTTCCCTGTCGATACAGG + Intergenic
1066324391 10:34342243-34342265 GACACAGTCTCTGTCCTTAAAGG + Intronic
1067780205 10:49196947-49196969 GACCCTATGCCTGTCCATTCAGG - Intergenic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1074051705 10:109886657-109886679 GACCCAGTCCCTGTCTTCATGGG + Intronic
1074640785 10:115378065-115378087 GACTCAGTCCCAGTCCATCTCGG - Intronic
1075881039 10:125850968-125850990 GACACAGTCACTGTCCATTGGGG - Intronic
1077141623 11:1027323-1027345 GGCCCAGTGCCCGTGCATACTGG - Exonic
1077460037 11:2704464-2704486 GACCCAGAGCCTGCCCATCCTGG - Intronic
1080062967 11:27977014-27977036 GACCAAGACACTGTCCAGACTGG - Intergenic
1080569348 11:33542227-33542249 GAGGAAGTCCCTGCCCATACTGG - Intronic
1084888627 11:72225518-72225540 CACTCAGTCCCTATCCAAACGGG - Intronic
1087667274 11:101065165-101065187 GACCTAGCCCCTATCCTTACAGG - Intronic
1090251503 11:125255026-125255048 TACACAGTCCCTGTCCTTTCAGG + Intronic
1091396947 12:159311-159333 GGCCCAGCCACTGTCCAGACTGG - Intronic
1091805563 12:3353664-3353686 GGCCCTGTCCATGTCCATGCGGG + Intergenic
1092528263 12:9323904-9323926 AACCCAGTTCCTGACCAGACGGG - Intergenic
1095940447 12:47723630-47723652 CAGCCACTCCCTATCCATACTGG + Intronic
1096919202 12:55065874-55065896 TCCCCAATCCCTGTCCACACTGG - Intergenic
1102080412 12:110093410-110093432 GTCCCAGCCACTGTGCATACTGG - Intergenic
1102942960 12:116960378-116960400 GTCTCAGTTCCTGTCAATACAGG + Intronic
1103126208 12:118424553-118424575 GCCCCAGTCCCTGTCCTCTCTGG - Intergenic
1103302186 12:119936443-119936465 GACACAATCCCTGTCCTTAAGGG - Intergenic
1103480653 12:121247998-121248020 GACCAAGTCCCTGTCCAGGAGGG - Intronic
1104470836 12:129028446-129028468 GACCCAGGTCCTTTCCATCCTGG + Intergenic
1104976247 12:132553230-132553252 GACACAGACCCTGCCCACACCGG + Intronic
1108829751 13:54462876-54462898 CATTCAGTCACTGTCCATACAGG - Intergenic
1111114919 13:83763236-83763258 GAACCAATCCCTCTGCATACTGG + Intergenic
1112478328 13:99752385-99752407 GACCAAGTCCCTGCCCACAGGGG + Intronic
1113732667 13:112653214-112653236 GACCCAGCCCCTTTCCATTATGG + Intronic
1125870384 15:43095395-43095417 GACACAGACCCTGTCCAGAATGG - Intronic
1125886493 15:43233645-43233667 GAACCAGCCACTCTCCATACAGG - Exonic
1128367050 15:67011934-67011956 GACCCAGTCCCTTGCCATCATGG + Intergenic
1128912209 15:71525897-71525919 GACCCATTCCCTGTCCTTGAGGG - Intronic
1129759970 15:78123660-78123682 GCCCCAGTCCCAGTCCCAACAGG + Intronic
1129775501 15:78233787-78233809 GGCCCAGGCCCTGTCCATCCAGG - Intronic
1132113637 15:99120249-99120271 GACCTAGTCCCTGTCCTCAGTGG + Intronic
1135831094 16:25774094-25774116 GAACTAGTCCCTGCCCATGCAGG + Intronic
1136132120 16:28229606-28229628 GACCCAGGCCCTTTCCATCTTGG + Intergenic
1141658951 16:85431276-85431298 CCTCCAGGCCCTGTCCATACGGG + Intergenic
1142152029 16:88516880-88516902 CACCCTGTCCCTGTTCATCCCGG - Intronic
1142436386 16:90061075-90061097 GACCCAGCCCCTTTCCACAATGG - Intronic
1144765705 17:17731326-17731348 GACCCAGCCCCTGTCCCTTTGGG - Intronic
1148091204 17:45023429-45023451 GACACTGTCCCTGTCCCTAGAGG + Exonic
1148556734 17:48583008-48583030 GATCCGGGCCCTGGCCATACAGG - Intronic
1151400995 17:73855984-73856006 GACCCACTCCCTGTCCTCAGGGG - Intergenic
1152275261 17:79352840-79352862 GACCCATTCCCAGTGCAGACAGG - Intronic
1152411037 17:80123242-80123264 GACCCTGTCCCTTCCCACACAGG - Intergenic
1152920280 17:83063101-83063123 GACCCTGTCCCTGCCCCAACAGG - Intergenic
1153752450 18:8246886-8246908 GACCAAATCCCTGTGCATACTGG - Intronic
1155337863 18:24783756-24783778 GACCTGGTCCCTGTCAAAACTGG - Intergenic
1156275012 18:35576025-35576047 CACCCCTTCCCTGTCCATAAAGG + Intergenic
1157425380 18:47580223-47580245 GAGCCAGCCCCTATCCAGACTGG - Intergenic
1160619262 18:80159712-80159734 GGTCCTGTCCCTGTCCTTACCGG + Exonic
1160915850 19:1496176-1496198 GACCCAGTGCCTGTCCAGGATGG + Intronic
1161397539 19:4052525-4052547 GTCCCAGTTCCTGTCCCCACGGG + Intronic
1161570860 19:5030326-5030348 GCCCCAGGCCCTGTCCTTCCTGG + Intronic
1167614805 19:50526474-50526496 GACCCAGTCCCTGCCCTCCCTGG - Intronic
928466278 2:31525850-31525872 TACCCACTCCCTGTCAATGCAGG - Exonic
929893733 2:45939927-45939949 AACCCAGCCCCTCACCATACTGG + Intronic
932533919 2:72570931-72570953 GTCACAGTCCTTGTACATACAGG - Intronic
932770479 2:74498318-74498340 GACCCCCTCCCTATCCCTACAGG - Exonic
936343015 2:111654212-111654234 GACCCTGAACCTGTCCACACTGG + Intergenic
938047991 2:128140370-128140392 GAACTTGTCCCTGTCCATGCAGG + Intronic
940281124 2:151990522-151990544 GACCCGGTCCCTGTTCCTCCTGG - Intronic
941400166 2:165020883-165020905 GATGTAGTCCCTGTCCATAAAGG + Intergenic
945019947 2:205560256-205560278 GACACAGTCCCTGTCCTTAAAGG - Intronic
945255328 2:207798452-207798474 TACCCAGTCCCTGTCCAAGATGG - Intergenic
946139113 2:217673112-217673134 CACCCAGTCCATGACTATACAGG - Intronic
948410159 2:237753035-237753057 GACCACATCCCTTTCCATACTGG + Intronic
948981620 2:241497636-241497658 GTCCCAGTGCCTGTCCACGCTGG - Exonic
1170767437 20:19302228-19302250 GCCCCAGCCCCTGCCCACACAGG - Intronic
1175244617 20:57574247-57574269 GACCCAGTCCCTTTCCAGGAAGG - Intergenic
1175595744 20:60231178-60231200 GACCAAGTCCCTGTCCTCAGTGG - Intergenic
1180260239 21:46663420-46663442 GACCCAGTCCCTGTCCATACAGG + Exonic
1182550313 22:31097350-31097372 CACCCAATCCCTGACCATAGAGG + Intronic
1183562221 22:38584199-38584221 GACACAGTCCCTGACCTTATGGG - Intronic
1183609744 22:38891661-38891683 GACACAGTCCCTGTTCATGGGGG + Intergenic
1183740404 22:39665636-39665658 AGCCCAGTCCCTGCCCAGACTGG - Intronic
1183991044 22:41597211-41597233 GTCCCAGTCCCTGTCACTTCTGG - Intergenic
1184517678 22:44972814-44972836 GACACAGTCCCTGTCTGTAGGGG - Intronic
1184596707 22:45518345-45518367 GATGCGGTCCCTGTCCAGACAGG - Intronic
1185334414 22:50265230-50265252 GCCCCAGTTCCTCTCCAGACTGG - Intronic
950682071 3:14592382-14592404 GACACAGAGCCTGTCCATGCAGG - Intergenic
951689654 3:25382417-25382439 TACCCAGTCCATGTCCCTGCAGG - Intronic
954688754 3:52384723-52384745 CACCCAGTCCCTGTCTTTCCTGG + Intronic
956171735 3:66438446-66438468 GAACCAGCCCCTCTCCTTACAGG + Intronic
959597335 3:108142781-108142803 GACCTGGTCCCTGCCCATATGGG - Intergenic
961886776 3:130101993-130102015 GACCCAGTGCCTGTCCACGTGGG - Intronic
967362678 3:188649509-188649531 AACCCAGTCCCTTTCCATGCGGG + Intronic
969105420 4:4803882-4803904 TACGCAGTCCCTGTACATATGGG - Intergenic
969185232 4:5469581-5469603 GCCCCAGTCCCAGTCGATGCTGG + Intronic
975887874 4:78986773-78986795 GACCCAGTCTCAGTCCTTTCAGG - Intergenic
978606682 4:110488046-110488068 TCCCCAGTCCCTGTCCCTAATGG - Intronic
979788560 4:124749105-124749127 GACCCAGTCTCTGTCATTATAGG - Intergenic
980309121 4:131102635-131102657 GAACCACCCCCTGTCCCTACAGG - Intergenic
981079209 4:140622366-140622388 GGCCCAGTCCCGGTCCAGGCTGG + Exonic
981138634 4:141240819-141240841 GTCCCAGACTCTGGCCATACAGG + Intergenic
983280439 4:165674238-165674260 GAGACAGTCCCTGCCCATAAAGG + Intergenic
984661342 4:182378982-182379004 TACCCAATGCCTGTGCATACTGG - Intronic
990976696 5:61567058-61567080 GACCCAGTCCCTGCCCTTGGGGG - Intergenic
994185029 5:96807556-96807578 GTCCCTGTCCCTGTCCCTCCGGG - Intronic
997053343 5:130409366-130409388 GACCCAGTCGTTGTACATTCAGG - Intergenic
998397719 5:141829766-141829788 GACCCACACCCTGTGCAGACTGG + Intergenic
1000399439 5:160811100-160811122 GACCCAGTCCCAGTCCTGGCAGG + Intronic
1001279814 5:170378718-170378740 CAACCAGTACCTGTCCATCCTGG - Exonic
1002714771 5:181220053-181220075 GACACAGGCCTGGTCCATACAGG - Intergenic
1007740126 6:44004906-44004928 GACACAGTCCCTGTCCTTTGGGG - Exonic
1010656901 6:78522057-78522079 TTCCCAGTCCTTGTCCTTACAGG - Intergenic
1013370947 6:109470558-109470580 CACCCAGCCCCTGTCCAGCCAGG + Intronic
1016273156 6:142314501-142314523 GGAGCAGTCCCTGTCAATACTGG + Intronic
1019529402 7:1495980-1496002 GTCCCCGTTCCTGTCCATCCGGG - Intronic
1025624578 7:63208739-63208761 TCCCCAGTCCCTGTCCCTAATGG - Intergenic
1026386906 7:69858842-69858864 GACTCAGTCTCTGGCCACACGGG - Intronic
1030953092 7:115817187-115817209 GACACAGACCCTGTACATTCTGG + Intergenic
1033120901 7:138665372-138665394 GACCCTGTCCCTGAGCTTACTGG - Intronic
1036848268 8:12184605-12184627 GACCCAGTGCCTGTCCACGTGGG - Intronic
1036869630 8:12426886-12426908 GACCCAGTGCCTGTCCACGTGGG - Intronic
1039040288 8:33401380-33401402 AACCCAGTTCATGTCCATGCAGG + Intronic
1045106224 8:98895423-98895445 GAACCACTTCCTCTCCATACTGG - Intronic
1048866340 8:138764382-138764404 GCCCCATTCCCTGCCCATCCTGG - Intronic
1049025357 8:139984563-139984585 GACCTGGTCCCTGTCCTTCCAGG - Intronic
1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG + Intergenic
1057268130 9:93632130-93632152 GACCCTGCCCCTGTCCCTGCAGG + Intronic
1057667898 9:97060973-97060995 GATCCAGCCCCTGTCCAGCCTGG - Intergenic
1058896147 9:109402150-109402172 GAGCCAGTCACAGTGCATACCGG - Intronic
1059020803 9:110574709-110574731 GACTCAGTCCCTGTCTAAACTGG - Intronic
1060520405 9:124290924-124290946 GACACAGTTCCTGTTCTTACAGG - Intronic
1061242840 9:129384192-129384214 GAGCAAGGCCCCGTCCATACTGG - Intergenic
1061550540 9:131331983-131332005 GACCCAGTCACTGTCCCCAGGGG + Intergenic
1189219160 X:39356286-39356308 CACCCAGACCCTGCCCACACTGG - Intergenic
1196931468 X:120685726-120685748 GGTCCAGTCCCTGTCCACAAAGG - Intergenic
1197115927 X:122833758-122833780 TACAGAGTCCCTGTCCATAAAGG + Intergenic
1200242629 X:154505872-154505894 ATCCCTGTCCCTGTCCGTACAGG + Intergenic