ID: 1180260277

View in Genome Browser
Species Human (GRCh38)
Location 21:46663632-46663654
Sequence GCAGATGCTGGCCCACACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180260266_1180260277 17 Left 1180260266 21:46663592-46663614 CCGGTCCTCAGGGAGACAGGCCT 0: 1
1: 0
2: 3
3: 31
4: 307
Right 1180260277 21:46663632-46663654 GCAGATGCTGGCCCACACTGGGG 0: 1
1: 0
2: 2
3: 25
4: 226
1180260263_1180260277 27 Left 1180260263 21:46663582-46663604 CCTGTGGGTGCCGGTCCTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1180260277 21:46663632-46663654 GCAGATGCTGGCCCACACTGGGG 0: 1
1: 0
2: 2
3: 25
4: 226
1180260273_1180260277 -3 Left 1180260273 21:46663612-46663634 CCTGGGTGGTGGTAGTGATGGCA 0: 1
1: 0
2: 2
3: 32
4: 298
Right 1180260277 21:46663632-46663654 GCAGATGCTGGCCCACACTGGGG 0: 1
1: 0
2: 2
3: 25
4: 226
1180260269_1180260277 12 Left 1180260269 21:46663597-46663619 CCTCAGGGAGACAGGCCTGGGTG 0: 1
1: 0
2: 6
3: 50
4: 414
Right 1180260277 21:46663632-46663654 GCAGATGCTGGCCCACACTGGGG 0: 1
1: 0
2: 2
3: 25
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180260277 Original CRISPR GCAGATGCTGGCCCACACTG GGG Intronic