ID: 1180264220

View in Genome Browser
Species Human (GRCh38)
Location 21:46699310-46699332
Sequence CAAAGGCGGCGCGCCGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180264220_1180264230 29 Left 1180264220 21:46699310-46699332 CCTCCGCCGGCGCGCCGCCTTTG No data
Right 1180264230 21:46699362-46699384 ACACCCGGAGAGCATCGCCAGGG No data
1180264220_1180264228 14 Left 1180264220 21:46699310-46699332 CCTCCGCCGGCGCGCCGCCTTTG No data
Right 1180264228 21:46699347-46699369 CGTTCTCTTTAGCACACACCCGG No data
1180264220_1180264229 28 Left 1180264220 21:46699310-46699332 CCTCCGCCGGCGCGCCGCCTTTG No data
Right 1180264229 21:46699361-46699383 CACACCCGGAGAGCATCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180264220 Original CRISPR CAAAGGCGGCGCGCCGGCGG AGG (reversed) Intergenic