ID: 1180269574

View in Genome Browser
Species Human (GRCh38)
Location 22:10572190-10572212
Sequence CGGCAAAAAGCCGCGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180269574_1180269583 6 Left 1180269574 22:10572190-10572212 CCCACCACCGCGGCTTTTTGCCG No data
Right 1180269583 22:10572219-10572241 GCCGTGGCTTTTTGACGCCCTGG No data
1180269574_1180269578 -10 Left 1180269574 22:10572190-10572212 CCCACCACCGCGGCTTTTTGCCG No data
Right 1180269578 22:10572203-10572225 CTTTTTGCCGCCCGCCGCCGTGG No data
1180269574_1180269587 28 Left 1180269574 22:10572190-10572212 CCCACCACCGCGGCTTTTTGCCG No data
Right 1180269587 22:10572241-10572263 GCTTTGCTCCCCCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180269574 Original CRISPR CGGCAAAAAGCCGCGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr