ID: 1180271906

View in Genome Browser
Species Human (GRCh38)
Location 22:10600069-10600091
Sequence ATTTTATTCTGAGACATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180271906_1180271908 -8 Left 1180271906 22:10600069-10600091 CCCTTGATGTCTCAGAATAAAAT No data
Right 1180271908 22:10600084-10600106 AATAAAATGATGAAACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180271906 Original CRISPR ATTTTATTCTGAGACATCAA GGG (reversed) Intergenic
No off target data available for this crispr