ID: 1180274481

View in Genome Browser
Species Human (GRCh38)
Location 22:10632014-10632036
Sequence CCTGGCACGGAGCAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180274481_1180274489 13 Left 1180274481 22:10632014-10632036 CCACCCAGCTGCTCCGTGCCAGG No data
Right 1180274489 22:10632050-10632072 ACCTAGAGCCTGCAACACCACGG No data
1180274481_1180274492 29 Left 1180274481 22:10632014-10632036 CCACCCAGCTGCTCCGTGCCAGG No data
Right 1180274492 22:10632066-10632088 ACCACGGCTCGCCTCGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180274481 Original CRISPR CCTGGCACGGAGCAGCTGGG TGG (reversed) Intergenic
No off target data available for this crispr