ID: 1180279758

View in Genome Browser
Species Human (GRCh38)
Location 22:10682953-10682975
Sequence CCTTTCTAGGACATCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180279758_1180279767 27 Left 1180279758 22:10682953-10682975 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1180279767 22:10683003-10683025 TGGGCGGTACCTGCCTATTGTGG No data
1180279758_1180279764 8 Left 1180279758 22:10682953-10682975 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1180279764 22:10682984-10683006 TGCTTCAGCTGTCCACTTTTGGG No data
1180279758_1180279763 7 Left 1180279758 22:10682953-10682975 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1180279763 22:10682983-10683005 GTGCTTCAGCTGTCCACTTTTGG No data
1180279758_1180279765 11 Left 1180279758 22:10682953-10682975 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1180279765 22:10682987-10683009 TTCAGCTGTCCACTTTTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180279758 Original CRISPR CCTTTCTAGGACATCCCTGA AGG (reversed) Intergenic