ID: 1180279767

View in Genome Browser
Species Human (GRCh38)
Location 22:10683003-10683025
Sequence TGGGCGGTACCTGCCTATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180279762_1180279767 14 Left 1180279762 22:10682966-10682988 CCTAGAAAGGGGCTGTAGTGCTT No data
Right 1180279767 22:10683003-10683025 TGGGCGGTACCTGCCTATTGTGG No data
1180279758_1180279767 27 Left 1180279758 22:10682953-10682975 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1180279767 22:10683003-10683025 TGGGCGGTACCTGCCTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180279767 Original CRISPR TGGGCGGTACCTGCCTATTG TGG Intergenic