ID: 1180279782

View in Genome Browser
Species Human (GRCh38)
Location 22:10683087-10683109
Sequence CCCCATGAGGTCATCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180279779_1180279782 3 Left 1180279779 22:10683061-10683083 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1180279782 22:10683087-10683109 CCCCATGAGGTCATCAGTGCAGG No data
1180279776_1180279782 8 Left 1180279776 22:10683056-10683078 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1180279782 22:10683087-10683109 CCCCATGAGGTCATCAGTGCAGG No data
1180279775_1180279782 11 Left 1180279775 22:10683053-10683075 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1180279782 22:10683087-10683109 CCCCATGAGGTCATCAGTGCAGG No data
1180279773_1180279782 18 Left 1180279773 22:10683046-10683068 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1180279782 22:10683087-10683109 CCCCATGAGGTCATCAGTGCAGG No data
1180279777_1180279782 7 Left 1180279777 22:10683057-10683079 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1180279782 22:10683087-10683109 CCCCATGAGGTCATCAGTGCAGG No data
1180279772_1180279782 23 Left 1180279772 22:10683041-10683063 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1180279782 22:10683087-10683109 CCCCATGAGGTCATCAGTGCAGG No data
1180279774_1180279782 17 Left 1180279774 22:10683047-10683069 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1180279782 22:10683087-10683109 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180279782 Original CRISPR CCCCATGAGGTCATCAGTGC AGG Intergenic
No off target data available for this crispr