ID: 1180279825

View in Genome Browser
Species Human (GRCh38)
Location 22:10683393-10683415
Sequence AGTTAACTGGAGAACATGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180279822_1180279825 14 Left 1180279822 22:10683356-10683378 CCAGTATAGGACAAGAGCTGTCT No data
Right 1180279825 22:10683393-10683415 AGTTAACTGGAGAACATGACCGG No data
1180279821_1180279825 15 Left 1180279821 22:10683355-10683377 CCCAGTATAGGACAAGAGCTGTC No data
Right 1180279825 22:10683393-10683415 AGTTAACTGGAGAACATGACCGG No data
1180279820_1180279825 24 Left 1180279820 22:10683346-10683368 CCACAAAAGCCCAGTATAGGACA No data
Right 1180279825 22:10683393-10683415 AGTTAACTGGAGAACATGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180279825 Original CRISPR AGTTAACTGGAGAACATGAC CGG Intergenic
No off target data available for this crispr