ID: 1180285904 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:10744137-10744159 |
| Sequence | CTGTAGCTAAGGAGAGGAGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1180285898_1180285904 | 25 | Left | 1180285898 | 22:10744089-10744111 | CCTGAGAGCAGCGTGGGTTTGAG | 0: 4 1: 1 2: 1 3: 12 4: 155 |
||
| Right | 1180285904 | 22:10744137-10744159 | CTGTAGCTAAGGAGAGGAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1180285904 | Original CRISPR | CTGTAGCTAAGGAGAGGAGG AGG | Intergenic | ||
| No off target data available for this crispr | |||||