ID: 1180285904

View in Genome Browser
Species Human (GRCh38)
Location 22:10744137-10744159
Sequence CTGTAGCTAAGGAGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180285898_1180285904 25 Left 1180285898 22:10744089-10744111 CCTGAGAGCAGCGTGGGTTTGAG 0: 4
1: 1
2: 1
3: 12
4: 155
Right 1180285904 22:10744137-10744159 CTGTAGCTAAGGAGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180285904 Original CRISPR CTGTAGCTAAGGAGAGGAGG AGG Intergenic
No off target data available for this crispr