ID: 1180286406

View in Genome Browser
Species Human (GRCh38)
Location 22:10748670-10748692
Sequence CTTTACTTCTTGATGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180286402_1180286406 -9 Left 1180286402 22:10748656-10748678 CCTCAGAACCTGGGCTTTACTTC 0: 5
1: 0
2: 0
3: 27
4: 450
Right 1180286406 22:10748670-10748692 CTTTACTTCTTGATGGGAGAAGG No data
1180286399_1180286406 7 Left 1180286399 22:10748640-10748662 CCAGATGGAGTCTGTTCCTCAGA 0: 4
1: 1
2: 2
3: 13
4: 137
Right 1180286406 22:10748670-10748692 CTTTACTTCTTGATGGGAGAAGG No data
1180286398_1180286406 20 Left 1180286398 22:10748627-10748649 CCAAACATGGTCTCCAGATGGAG 0: 5
1: 0
2: 0
3: 10
4: 147
Right 1180286406 22:10748670-10748692 CTTTACTTCTTGATGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180286406 Original CRISPR CTTTACTTCTTGATGGGAGA AGG Intergenic
No off target data available for this crispr