ID: 1180289581

View in Genome Browser
Species Human (GRCh38)
Location 22:10784484-10784506
Sequence TGGGGTGGGTAAGAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180289581_1180289596 19 Left 1180289581 22:10784484-10784506 CCAGCAGCTTCTTACCCACCCCA No data
Right 1180289596 22:10784526-10784548 GCTCTCCTACTTCCCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180289581 Original CRISPR TGGGGTGGGTAAGAAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr