ID: 1180294527

View in Genome Browser
Species Human (GRCh38)
Location 22:10872963-10872985
Sequence CTGCGGCAGGCAGTGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180294527_1180294537 15 Left 1180294527 22:10872963-10872985 CCACTGGCCACTGCCTGCCGCAG No data
Right 1180294537 22:10873001-10873023 TCAAAGGCAGGCCTGCCCTCCGG No data
1180294527_1180294531 -1 Left 1180294527 22:10872963-10872985 CCACTGGCCACTGCCTGCCGCAG No data
Right 1180294531 22:10872985-10873007 GCCCTGCCTCACAGCCTCAAAGG No data
1180294527_1180294538 16 Left 1180294527 22:10872963-10872985 CCACTGGCCACTGCCTGCCGCAG No data
Right 1180294538 22:10873002-10873024 CAAAGGCAGGCCTGCCCTCCGGG No data
1180294527_1180294534 3 Left 1180294527 22:10872963-10872985 CCACTGGCCACTGCCTGCCGCAG No data
Right 1180294534 22:10872989-10873011 TGCCTCACAGCCTCAAAGGCAGG No data
1180294527_1180294541 30 Left 1180294527 22:10872963-10872985 CCACTGGCCACTGCCTGCCGCAG No data
Right 1180294541 22:10873016-10873038 CCCTCCGGGCACCTCTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180294527 Original CRISPR CTGCGGCAGGCAGTGGCCAG TGG (reversed) Intergenic
No off target data available for this crispr