ID: 1180295318

View in Genome Browser
Species Human (GRCh38)
Location 22:10928987-10929009
Sequence AAGTCCTTCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180295318_1180295319 2 Left 1180295318 22:10928987-10929009 CCTTCACTCTTCTAGAAGGACTT No data
Right 1180295319 22:10929012-10929034 TTTGATAGTTCCTTTTTCCATGG No data
1180295318_1180295321 18 Left 1180295318 22:10928987-10929009 CCTTCACTCTTCTAGAAGGACTT No data
Right 1180295321 22:10929028-10929050 TCCATGGTTTAGAATAAAAGAGG 0: 17
1: 21
2: 24
3: 47
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180295318 Original CRISPR AAGTCCTTCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr