ID: 1180296218

View in Genome Browser
Species Human (GRCh38)
Location 22:10938444-10938466
Sequence ACATGGCATCTGTACAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180296218_1180296223 25 Left 1180296218 22:10938444-10938466 CCTAGCTTGTACAGATGCCATGT No data
Right 1180296223 22:10938492-10938514 ATTTAAGGCTAGAACTAGATAGG No data
1180296218_1180296221 1 Left 1180296218 22:10938444-10938466 CCTAGCTTGTACAGATGCCATGT No data
Right 1180296221 22:10938468-10938490 ACTCTAGATTTGGTGACAGAAGG No data
1180296218_1180296224 26 Left 1180296218 22:10938444-10938466 CCTAGCTTGTACAGATGCCATGT No data
Right 1180296224 22:10938493-10938515 TTTAAGGCTAGAACTAGATAGGG No data
1180296218_1180296219 -9 Left 1180296218 22:10938444-10938466 CCTAGCTTGTACAGATGCCATGT No data
Right 1180296219 22:10938458-10938480 ATGCCATGTAACTCTAGATTTGG No data
1180296218_1180296222 10 Left 1180296218 22:10938444-10938466 CCTAGCTTGTACAGATGCCATGT No data
Right 1180296222 22:10938477-10938499 TTGGTGACAGAAGGAATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180296218 Original CRISPR ACATGGCATCTGTACAAGCT AGG (reversed) Intergenic
No off target data available for this crispr