ID: 1180297959 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:10961655-10961677 |
Sequence | CCAGCACCGGCGCCTCGGGC GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1180297959_1180297973 | 30 | Left | 1180297959 | 22:10961655-10961677 | CCCGCCCGAGGCGCCGGTGCTGG | No data | ||
Right | 1180297973 | 22:10961708-10961730 | ACGGCCTCCCGCTAGAGCTGCGG | No data | ||||
1180297959_1180297971 | 11 | Left | 1180297959 | 22:10961655-10961677 | CCCGCCCGAGGCGCCGGTGCTGG | No data | ||
Right | 1180297971 | 22:10961689-10961711 | CTGCCGGTCGCGCTGTGAAACGG | No data | ||||
1180297959_1180297970 | -5 | Left | 1180297959 | 22:10961655-10961677 | CCCGCCCGAGGCGCCGGTGCTGG | No data | ||
Right | 1180297970 | 22:10961673-10961695 | GCTGGCGGTGGCGGGGCTGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1180297959 | Original CRISPR | CCAGCACCGGCGCCTCGGGC GGG (reversed) | Intergenic | ||