ID: 1180297959

View in Genome Browser
Species Human (GRCh38)
Location 22:10961655-10961677
Sequence CCAGCACCGGCGCCTCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180297959_1180297973 30 Left 1180297959 22:10961655-10961677 CCCGCCCGAGGCGCCGGTGCTGG No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data
1180297959_1180297971 11 Left 1180297959 22:10961655-10961677 CCCGCCCGAGGCGCCGGTGCTGG No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data
1180297959_1180297970 -5 Left 1180297959 22:10961655-10961677 CCCGCCCGAGGCGCCGGTGCTGG No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180297959 Original CRISPR CCAGCACCGGCGCCTCGGGC GGG (reversed) Intergenic