ID: 1180297961

View in Genome Browser
Species Human (GRCh38)
Location 22:10961656-10961678
Sequence GCCAGCACCGGCGCCTCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180297961_1180297974 30 Left 1180297961 22:10961656-10961678 CCGCCCGAGGCGCCGGTGCTGGC No data
Right 1180297974 22:10961709-10961731 CGGCCTCCCGCTAGAGCTGCGGG No data
1180297961_1180297973 29 Left 1180297961 22:10961656-10961678 CCGCCCGAGGCGCCGGTGCTGGC No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data
1180297961_1180297970 -6 Left 1180297961 22:10961656-10961678 CCGCCCGAGGCGCCGGTGCTGGC No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data
1180297961_1180297971 10 Left 1180297961 22:10961656-10961678 CCGCCCGAGGCGCCGGTGCTGGC No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180297961 Original CRISPR GCCAGCACCGGCGCCTCGGG CGG (reversed) Intergenic