ID: 1180297963

View in Genome Browser
Species Human (GRCh38)
Location 22:10961659-10961681
Sequence ACCGCCAGCACCGGCGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180297963_1180297971 7 Left 1180297963 22:10961659-10961681 CCCGAGGCGCCGGTGCTGGCGGT No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data
1180297963_1180297973 26 Left 1180297963 22:10961659-10961681 CCCGAGGCGCCGGTGCTGGCGGT No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data
1180297963_1180297974 27 Left 1180297963 22:10961659-10961681 CCCGAGGCGCCGGTGCTGGCGGT No data
Right 1180297974 22:10961709-10961731 CGGCCTCCCGCTAGAGCTGCGGG No data
1180297963_1180297970 -9 Left 1180297963 22:10961659-10961681 CCCGAGGCGCCGGTGCTGGCGGT No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180297963 Original CRISPR ACCGCCAGCACCGGCGCCTC GGG (reversed) Intergenic