ID: 1180297964

View in Genome Browser
Species Human (GRCh38)
Location 22:10961660-10961682
Sequence CACCGCCAGCACCGGCGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180297964_1180297970 -10 Left 1180297964 22:10961660-10961682 CCGAGGCGCCGGTGCTGGCGGTG No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data
1180297964_1180297973 25 Left 1180297964 22:10961660-10961682 CCGAGGCGCCGGTGCTGGCGGTG No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data
1180297964_1180297971 6 Left 1180297964 22:10961660-10961682 CCGAGGCGCCGGTGCTGGCGGTG No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data
1180297964_1180297976 30 Left 1180297964 22:10961660-10961682 CCGAGGCGCCGGTGCTGGCGGTG No data
Right 1180297976 22:10961713-10961735 CTCCCGCTAGAGCTGCGGGCTGG No data
1180297964_1180297974 26 Left 1180297964 22:10961660-10961682 CCGAGGCGCCGGTGCTGGCGGTG No data
Right 1180297974 22:10961709-10961731 CGGCCTCCCGCTAGAGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180297964 Original CRISPR CACCGCCAGCACCGGCGCCT CGG (reversed) Intergenic