ID: 1180297969

View in Genome Browser
Species Human (GRCh38)
Location 22:10961668-10961690
Sequence AGCCCCGCCACCGCCAGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180297969_1180297979 28 Left 1180297969 22:10961668-10961690 CCGGTGCTGGCGGTGGCGGGGCT No data
Right 1180297979 22:10961719-10961741 CTAGAGCTGCGGGCTGGCGACGG No data
1180297969_1180297971 -2 Left 1180297969 22:10961668-10961690 CCGGTGCTGGCGGTGGCGGGGCT No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data
1180297969_1180297974 18 Left 1180297969 22:10961668-10961690 CCGGTGCTGGCGGTGGCGGGGCT No data
Right 1180297974 22:10961709-10961731 CGGCCTCCCGCTAGAGCTGCGGG No data
1180297969_1180297976 22 Left 1180297969 22:10961668-10961690 CCGGTGCTGGCGGTGGCGGGGCT No data
Right 1180297976 22:10961713-10961735 CTCCCGCTAGAGCTGCGGGCTGG No data
1180297969_1180297973 17 Left 1180297969 22:10961668-10961690 CCGGTGCTGGCGGTGGCGGGGCT No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180297969 Original CRISPR AGCCCCGCCACCGCCAGCAC CGG (reversed) Intergenic