ID: 1180297970

View in Genome Browser
Species Human (GRCh38)
Location 22:10961673-10961695
Sequence GCTGGCGGTGGCGGGGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180297959_1180297970 -5 Left 1180297959 22:10961655-10961677 CCCGCCCGAGGCGCCGGTGCTGG No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data
1180297964_1180297970 -10 Left 1180297964 22:10961660-10961682 CCGAGGCGCCGGTGCTGGCGGTG No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data
1180297950_1180297970 29 Left 1180297950 22:10961621-10961643 CCCAAGGATTCACGCCTCCCTGA No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data
1180297955_1180297970 12 Left 1180297955 22:10961638-10961660 CCCTGACGGGAGTAAAGCCCGCC No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data
1180297963_1180297970 -9 Left 1180297963 22:10961659-10961681 CCCGAGGCGCCGGTGCTGGCGGT No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data
1180297949_1180297970 30 Left 1180297949 22:10961620-10961642 CCCCAAGGATTCACGCCTCCCTG No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data
1180297961_1180297970 -6 Left 1180297961 22:10961656-10961678 CCGCCCGAGGCGCCGGTGCTGGC No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data
1180297954_1180297970 15 Left 1180297954 22:10961635-10961657 CCTCCCTGACGGGAGTAAAGCCC No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data
1180297951_1180297970 28 Left 1180297951 22:10961622-10961644 CCAAGGATTCACGCCTCCCTGAC No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data
1180297956_1180297970 11 Left 1180297956 22:10961639-10961661 CCTGACGGGAGTAAAGCCCGCCC No data
Right 1180297970 22:10961673-10961695 GCTGGCGGTGGCGGGGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180297970 Original CRISPR GCTGGCGGTGGCGGGGCTGC CGG Intergenic