ID: 1180297971

View in Genome Browser
Species Human (GRCh38)
Location 22:10961689-10961711
Sequence CTGCCGGTCGCGCTGTGAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180297961_1180297971 10 Left 1180297961 22:10961656-10961678 CCGCCCGAGGCGCCGGTGCTGGC No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data
1180297959_1180297971 11 Left 1180297959 22:10961655-10961677 CCCGCCCGAGGCGCCGGTGCTGG No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data
1180297955_1180297971 28 Left 1180297955 22:10961638-10961660 CCCTGACGGGAGTAAAGCCCGCC No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data
1180297964_1180297971 6 Left 1180297964 22:10961660-10961682 CCGAGGCGCCGGTGCTGGCGGTG No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data
1180297963_1180297971 7 Left 1180297963 22:10961659-10961681 CCCGAGGCGCCGGTGCTGGCGGT No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data
1180297969_1180297971 -2 Left 1180297969 22:10961668-10961690 CCGGTGCTGGCGGTGGCGGGGCT No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data
1180297956_1180297971 27 Left 1180297956 22:10961639-10961661 CCTGACGGGAGTAAAGCCCGCCC No data
Right 1180297971 22:10961689-10961711 CTGCCGGTCGCGCTGTGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180297971 Original CRISPR CTGCCGGTCGCGCTGTGAAA CGG Intergenic