ID: 1180297972

View in Genome Browser
Species Human (GRCh38)
Location 22:10961692-10961714
Sequence AGGCCGTTTCACAGCGCGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180297972_1180297982 15 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297982 22:10961730-10961752 GGCTGGCGACGGTCCCCGCGGGG No data
1180297972_1180297983 16 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297983 22:10961731-10961753 GCTGGCGACGGTCCCCGCGGGGG No data
1180297972_1180297984 19 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297984 22:10961734-10961756 GGCGACGGTCCCCGCGGGGGCGG No data
1180297972_1180297981 14 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297981 22:10961729-10961751 GGGCTGGCGACGGTCCCCGCGGG No data
1180297972_1180297973 -7 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data
1180297972_1180297979 4 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297979 22:10961719-10961741 CTAGAGCTGCGGGCTGGCGACGG No data
1180297972_1180297985 20 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297985 22:10961735-10961757 GCGACGGTCCCCGCGGGGGCGGG No data
1180297972_1180297976 -2 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297976 22:10961713-10961735 CTCCCGCTAGAGCTGCGGGCTGG No data
1180297972_1180297980 13 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297980 22:10961728-10961750 CGGGCTGGCGACGGTCCCCGCGG No data
1180297972_1180297974 -6 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297974 22:10961709-10961731 CGGCCTCCCGCTAGAGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180297972 Original CRISPR AGGCCGTTTCACAGCGCGAC CGG (reversed) Intergenic