ID: 1180297973

View in Genome Browser
Species Human (GRCh38)
Location 22:10961708-10961730
Sequence ACGGCCTCCCGCTAGAGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180297961_1180297973 29 Left 1180297961 22:10961656-10961678 CCGCCCGAGGCGCCGGTGCTGGC No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data
1180297972_1180297973 -7 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data
1180297969_1180297973 17 Left 1180297969 22:10961668-10961690 CCGGTGCTGGCGGTGGCGGGGCT No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data
1180297959_1180297973 30 Left 1180297959 22:10961655-10961677 CCCGCCCGAGGCGCCGGTGCTGG No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data
1180297963_1180297973 26 Left 1180297963 22:10961659-10961681 CCCGAGGCGCCGGTGCTGGCGGT No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data
1180297964_1180297973 25 Left 1180297964 22:10961660-10961682 CCGAGGCGCCGGTGCTGGCGGTG No data
Right 1180297973 22:10961708-10961730 ACGGCCTCCCGCTAGAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180297973 Original CRISPR ACGGCCTCCCGCTAGAGCTG CGG Intergenic