ID: 1180297976

View in Genome Browser
Species Human (GRCh38)
Location 22:10961713-10961735
Sequence CTCCCGCTAGAGCTGCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180297969_1180297976 22 Left 1180297969 22:10961668-10961690 CCGGTGCTGGCGGTGGCGGGGCT No data
Right 1180297976 22:10961713-10961735 CTCCCGCTAGAGCTGCGGGCTGG No data
1180297964_1180297976 30 Left 1180297964 22:10961660-10961682 CCGAGGCGCCGGTGCTGGCGGTG No data
Right 1180297976 22:10961713-10961735 CTCCCGCTAGAGCTGCGGGCTGG No data
1180297972_1180297976 -2 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297976 22:10961713-10961735 CTCCCGCTAGAGCTGCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180297976 Original CRISPR CTCCCGCTAGAGCTGCGGGC TGG Intergenic