ID: 1180297979 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:10961719-10961741 |
Sequence | CTAGAGCTGCGGGCTGGCGA CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1180297969_1180297979 | 28 | Left | 1180297969 | 22:10961668-10961690 | CCGGTGCTGGCGGTGGCGGGGCT | No data | ||
Right | 1180297979 | 22:10961719-10961741 | CTAGAGCTGCGGGCTGGCGACGG | No data | ||||
1180297972_1180297979 | 4 | Left | 1180297972 | 22:10961692-10961714 | CCGGTCGCGCTGTGAAACGGCCT | No data | ||
Right | 1180297979 | 22:10961719-10961741 | CTAGAGCTGCGGGCTGGCGACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1180297979 | Original CRISPR | CTAGAGCTGCGGGCTGGCGA CGG | Intergenic | ||