ID: 1180297979

View in Genome Browser
Species Human (GRCh38)
Location 22:10961719-10961741
Sequence CTAGAGCTGCGGGCTGGCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180297972_1180297979 4 Left 1180297972 22:10961692-10961714 CCGGTCGCGCTGTGAAACGGCCT No data
Right 1180297979 22:10961719-10961741 CTAGAGCTGCGGGCTGGCGACGG No data
1180297969_1180297979 28 Left 1180297969 22:10961668-10961690 CCGGTGCTGGCGGTGGCGGGGCT No data
Right 1180297979 22:10961719-10961741 CTAGAGCTGCGGGCTGGCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180297979 Original CRISPR CTAGAGCTGCGGGCTGGCGA CGG Intergenic
No off target data available for this crispr