ID: 1180303624

View in Genome Browser
Species Human (GRCh38)
Location 22:11055980-11056002
Sequence GAGCCTGCACACTGCGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180303620_1180303624 10 Left 1180303620 22:11055947-11055969 CCTAGGGGCAGGAGGAGGGGAGT No data
Right 1180303624 22:11055980-11056002 GAGCCTGCACACTGCGTGGAAGG No data
1180303619_1180303624 11 Left 1180303619 22:11055946-11055968 CCCTAGGGGCAGGAGGAGGGGAG No data
Right 1180303624 22:11055980-11056002 GAGCCTGCACACTGCGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180303624 Original CRISPR GAGCCTGCACACTGCGTGGA AGG Intergenic