ID: 1180303978

View in Genome Browser
Species Human (GRCh38)
Location 22:11058301-11058323
Sequence GCATTAGCAGCGCCCCTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180303968_1180303978 17 Left 1180303968 22:11058261-11058283 CCCAGCCTCCGACCTCTTAGACC No data
Right 1180303978 22:11058301-11058323 GCATTAGCAGCGCCCCTGCACGG No data
1180303970_1180303978 12 Left 1180303970 22:11058266-11058288 CCTCCGACCTCTTAGACCCACTG No data
Right 1180303978 22:11058301-11058323 GCATTAGCAGCGCCCCTGCACGG No data
1180303972_1180303978 5 Left 1180303972 22:11058273-11058295 CCTCTTAGACCCACTGAGCCTCG No data
Right 1180303978 22:11058301-11058323 GCATTAGCAGCGCCCCTGCACGG No data
1180303971_1180303978 9 Left 1180303971 22:11058269-11058291 CCGACCTCTTAGACCCACTGAGC No data
Right 1180303978 22:11058301-11058323 GCATTAGCAGCGCCCCTGCACGG No data
1180303969_1180303978 16 Left 1180303969 22:11058262-11058284 CCAGCCTCCGACCTCTTAGACCC No data
Right 1180303978 22:11058301-11058323 GCATTAGCAGCGCCCCTGCACGG No data
1180303975_1180303978 -4 Left 1180303975 22:11058282-11058304 CCCACTGAGCCTCGCAAGGGCAT No data
Right 1180303978 22:11058301-11058323 GCATTAGCAGCGCCCCTGCACGG No data
1180303976_1180303978 -5 Left 1180303976 22:11058283-11058305 CCACTGAGCCTCGCAAGGGCATT No data
Right 1180303978 22:11058301-11058323 GCATTAGCAGCGCCCCTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180303978 Original CRISPR GCATTAGCAGCGCCCCTGCA CGG Intergenic
No off target data available for this crispr