ID: 1180305316

View in Genome Browser
Species Human (GRCh38)
Location 22:11068315-11068337
Sequence TGGGGTGGGTAAGAAGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180305301_1180305316 19 Left 1180305301 22:11068273-11068295 CCAGGAAGGGGAAGTAGGAGAGC No data
Right 1180305316 22:11068315-11068337 TGGGGTGGGTAAGAAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180305316 Original CRISPR TGGGGTGGGTAAGAAGCTGC TGG Intergenic
No off target data available for this crispr