ID: 1180308751

View in Genome Browser
Species Human (GRCh38)
Location 22:11151421-11151443
Sequence GGCCAGTGGGAACAGCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180308751_1180308757 -1 Left 1180308751 22:11151421-11151443 CCATGGAGCTGTTCCCACTGGCC No data
Right 1180308757 22:11151443-11151465 CCCTAGCTAGAGGTGAGTGTAGG No data
1180308751_1180308761 28 Left 1180308751 22:11151421-11151443 CCATGGAGCTGTTCCCACTGGCC No data
Right 1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG No data
1180308751_1180308760 27 Left 1180308751 22:11151421-11151443 CCATGGAGCTGTTCCCACTGGCC No data
Right 1180308760 22:11151471-11151493 GAAACATGAACAAATGGAGCTGG No data
1180308751_1180308759 21 Left 1180308751 22:11151421-11151443 CCATGGAGCTGTTCCCACTGGCC No data
Right 1180308759 22:11151465-11151487 GACTTTGAAACATGAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180308751 Original CRISPR GGCCAGTGGGAACAGCTCCA TGG (reversed) Intergenic
No off target data available for this crispr