ID: 1180308754

View in Genome Browser
Species Human (GRCh38)
Location 22:11151435-11151457
Sequence CACCTCTAGCTAGGGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180308754_1180308765 28 Left 1180308754 22:11151435-11151457 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1180308765 22:11151486-11151508 GGAGCTGGGATGGCAATGGCGGG No data
1180308754_1180308764 27 Left 1180308754 22:11151435-11151457 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1180308764 22:11151485-11151507 TGGAGCTGGGATGGCAATGGCGG No data
1180308754_1180308761 14 Left 1180308754 22:11151435-11151457 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG No data
1180308754_1180308763 24 Left 1180308754 22:11151435-11151457 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1180308763 22:11151482-11151504 AAATGGAGCTGGGATGGCAATGG No data
1180308754_1180308762 18 Left 1180308754 22:11151435-11151457 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1180308762 22:11151476-11151498 ATGAACAAATGGAGCTGGGATGG No data
1180308754_1180308759 7 Left 1180308754 22:11151435-11151457 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1180308759 22:11151465-11151487 GACTTTGAAACATGAACAAATGG No data
1180308754_1180308760 13 Left 1180308754 22:11151435-11151457 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1180308760 22:11151471-11151493 GAAACATGAACAAATGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180308754 Original CRISPR CACCTCTAGCTAGGGGCCAG TGG (reversed) Intergenic
No off target data available for this crispr