ID: 1180308756

View in Genome Browser
Species Human (GRCh38)
Location 22:11151443-11151465
Sequence CCTACACTCACCTCTAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180308756_1180308759 -1 Left 1180308756 22:11151443-11151465 CCCTAGCTAGAGGTGAGTGTAGG No data
Right 1180308759 22:11151465-11151487 GACTTTGAAACATGAACAAATGG No data
1180308756_1180308762 10 Left 1180308756 22:11151443-11151465 CCCTAGCTAGAGGTGAGTGTAGG No data
Right 1180308762 22:11151476-11151498 ATGAACAAATGGAGCTGGGATGG No data
1180308756_1180308764 19 Left 1180308756 22:11151443-11151465 CCCTAGCTAGAGGTGAGTGTAGG No data
Right 1180308764 22:11151485-11151507 TGGAGCTGGGATGGCAATGGCGG No data
1180308756_1180308760 5 Left 1180308756 22:11151443-11151465 CCCTAGCTAGAGGTGAGTGTAGG No data
Right 1180308760 22:11151471-11151493 GAAACATGAACAAATGGAGCTGG No data
1180308756_1180308761 6 Left 1180308756 22:11151443-11151465 CCCTAGCTAGAGGTGAGTGTAGG No data
Right 1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG No data
1180308756_1180308763 16 Left 1180308756 22:11151443-11151465 CCCTAGCTAGAGGTGAGTGTAGG No data
Right 1180308763 22:11151482-11151504 AAATGGAGCTGGGATGGCAATGG No data
1180308756_1180308765 20 Left 1180308756 22:11151443-11151465 CCCTAGCTAGAGGTGAGTGTAGG No data
Right 1180308765 22:11151486-11151508 GGAGCTGGGATGGCAATGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180308756 Original CRISPR CCTACACTCACCTCTAGCTA GGG (reversed) Intergenic
No off target data available for this crispr