ID: 1180308761

View in Genome Browser
Species Human (GRCh38)
Location 22:11151472-11151494
Sequence AAACATGAACAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180308754_1180308761 14 Left 1180308754 22:11151435-11151457 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG No data
1180308755_1180308761 7 Left 1180308755 22:11151442-11151464 CCCCTAGCTAGAGGTGAGTGTAG No data
Right 1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG No data
1180308753_1180308761 15 Left 1180308753 22:11151434-11151456 CCCACTGGCCCCTAGCTAGAGGT No data
Right 1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG No data
1180308751_1180308761 28 Left 1180308751 22:11151421-11151443 CCATGGAGCTGTTCCCACTGGCC No data
Right 1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG No data
1180308758_1180308761 5 Left 1180308758 22:11151444-11151466 CCTAGCTAGAGGTGAGTGTAGGA No data
Right 1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG No data
1180308756_1180308761 6 Left 1180308756 22:11151443-11151465 CCCTAGCTAGAGGTGAGTGTAGG No data
Right 1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180308761 Original CRISPR AAACATGAACAAATGGAGCT GGG Intergenic
No off target data available for this crispr