ID: 1180309637

View in Genome Browser
Species Human (GRCh38)
Location 22:11158767-11158789
Sequence GCCGCGTCCACCTGGAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180309637_1180309640 -10 Left 1180309637 22:11158767-11158789 CCTTAGCTCCAGGTGGACGCGGC No data
Right 1180309640 22:11158780-11158802 TGGACGCGGCCCGGACCCCGTGG No data
1180309637_1180309647 14 Left 1180309637 22:11158767-11158789 CCTTAGCTCCAGGTGGACGCGGC No data
Right 1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG No data
1180309637_1180309641 -4 Left 1180309637 22:11158767-11158789 CCTTAGCTCCAGGTGGACGCGGC No data
Right 1180309641 22:11158786-11158808 CGGCCCGGACCCCGTGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180309637 Original CRISPR GCCGCGTCCACCTGGAGCTA AGG (reversed) Intergenic
No off target data available for this crispr