ID: 1180309639

View in Genome Browser
Species Human (GRCh38)
Location 22:11158775-11158797
Sequence GGGTCCGGGCCGCGTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180309639_1180309647 6 Left 1180309639 22:11158775-11158797 CCAGGTGGACGCGGCCCGGACCC No data
Right 1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG No data
1180309639_1180309653 25 Left 1180309639 22:11158775-11158797 CCAGGTGGACGCGGCCCGGACCC No data
Right 1180309653 22:11158823-11158845 CCGGCGCCCGAGCCGACCCAAGG No data
1180309639_1180309654 26 Left 1180309639 22:11158775-11158797 CCAGGTGGACGCGGCCCGGACCC No data
Right 1180309654 22:11158824-11158846 CGGCGCCCGAGCCGACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180309639 Original CRISPR GGGTCCGGGCCGCGTCCACC TGG (reversed) Intergenic
No off target data available for this crispr