ID: 1180309640

View in Genome Browser
Species Human (GRCh38)
Location 22:11158780-11158802
Sequence TGGACGCGGCCCGGACCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180309637_1180309640 -10 Left 1180309637 22:11158767-11158789 CCTTAGCTCCAGGTGGACGCGGC No data
Right 1180309640 22:11158780-11158802 TGGACGCGGCCCGGACCCCGTGG No data
1180309632_1180309640 5 Left 1180309632 22:11158752-11158774 CCTAGCTGGCGGGACCCTTAGCT No data
Right 1180309640 22:11158780-11158802 TGGACGCGGCCCGGACCCCGTGG No data
1180309635_1180309640 -9 Left 1180309635 22:11158766-11158788 CCCTTAGCTCCAGGTGGACGCGG No data
Right 1180309640 22:11158780-11158802 TGGACGCGGCCCGGACCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180309640 Original CRISPR TGGACGCGGCCCGGACCCCG TGG Intergenic
No off target data available for this crispr