ID: 1180309647

View in Genome Browser
Species Human (GRCh38)
Location 22:11158804-11158826
Sequence TATGGAGCAGTCGCCGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180309632_1180309647 29 Left 1180309632 22:11158752-11158774 CCTAGCTGGCGGGACCCTTAGCT No data
Right 1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG No data
1180309643_1180309647 -9 Left 1180309643 22:11158790-11158812 CCGGACCCCGTGGATATGGAGCA No data
Right 1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG No data
1180309635_1180309647 15 Left 1180309635 22:11158766-11158788 CCCTTAGCTCCAGGTGGACGCGG No data
Right 1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG No data
1180309642_1180309647 -8 Left 1180309642 22:11158789-11158811 CCCGGACCCCGTGGATATGGAGC No data
Right 1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG No data
1180309639_1180309647 6 Left 1180309639 22:11158775-11158797 CCAGGTGGACGCGGCCCGGACCC No data
Right 1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG No data
1180309637_1180309647 14 Left 1180309637 22:11158767-11158789 CCTTAGCTCCAGGTGGACGCGGC No data
Right 1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180309647 Original CRISPR TATGGAGCAGTCGCCGCCCC CGG Intergenic
No off target data available for this crispr