ID: 1180310155

View in Genome Browser
Species Human (GRCh38)
Location 22:11216795-11216817
Sequence GAGGTGAACTTTCTTTTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180310153_1180310155 25 Left 1180310153 22:11216747-11216769 CCAAAACTTTCTGAGAAACTTTC No data
Right 1180310155 22:11216795-11216817 GAGGTGAACTTTCTTTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180310155 Original CRISPR GAGGTGAACTTTCTTTTGAT TGG Intergenic
No off target data available for this crispr