ID: 1180312514

View in Genome Browser
Species Human (GRCh38)
Location 22:11251717-11251739
Sequence TTTCTTGGAAGCTGCCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180312509_1180312514 -2 Left 1180312509 22:11251696-11251718 CCAAAAACCCAAAGACTTTGGTT No data
Right 1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG No data
1180312503_1180312514 16 Left 1180312503 22:11251678-11251700 CCATACTCCCCTCGGAACCCAAA No data
Right 1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG No data
1180312505_1180312514 8 Left 1180312505 22:11251686-11251708 CCCTCGGAACCCAAAAACCCAAA No data
Right 1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG No data
1180312511_1180312514 -9 Left 1180312511 22:11251703-11251725 CCCAAAGACTTTGGTTTCTTGGA No data
Right 1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG No data
1180312504_1180312514 9 Left 1180312504 22:11251685-11251707 CCCCTCGGAACCCAAAAACCCAA No data
Right 1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG No data
1180312506_1180312514 7 Left 1180312506 22:11251687-11251709 CCTCGGAACCCAAAAACCCAAAG No data
Right 1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG No data
1180312512_1180312514 -10 Left 1180312512 22:11251704-11251726 CCAAAGACTTTGGTTTCTTGGAA No data
Right 1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG No data
1180312508_1180312514 -1 Left 1180312508 22:11251695-11251717 CCCAAAAACCCAAAGACTTTGGT No data
Right 1180312514 22:11251717-11251739 TTTCTTGGAAGCTGCCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180312514 Original CRISPR TTTCTTGGAAGCTGCCCAGC GGG Intergenic
No off target data available for this crispr