ID: 1180312843

View in Genome Browser
Species Human (GRCh38)
Location 22:11253390-11253412
Sequence GGTCCCGAAGGCGCACGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180312836_1180312843 -1 Left 1180312836 22:11253368-11253390 CCACTCGGGGTGCCGCCGACCTG No data
Right 1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG No data
1180312827_1180312843 20 Left 1180312827 22:11253347-11253369 CCTTCCGGGTGCCCACCAGGCCC No data
Right 1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG No data
1180312825_1180312843 25 Left 1180312825 22:11253342-11253364 CCAAACCTTCCGGGTGCCCACCA No data
Right 1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG No data
1180312834_1180312843 5 Left 1180312834 22:11253362-11253384 CCAGGCCCACTCGGGGTGCCGCC No data
Right 1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG No data
1180312833_1180312843 8 Left 1180312833 22:11253359-11253381 CCACCAGGCCCACTCGGGGTGCC No data
Right 1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG No data
1180312832_1180312843 9 Left 1180312832 22:11253358-11253380 CCCACCAGGCCCACTCGGGGTGC No data
Right 1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG No data
1180312835_1180312843 0 Left 1180312835 22:11253367-11253389 CCCACTCGGGGTGCCGCCGACCT No data
Right 1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG No data
1180312823_1180312843 27 Left 1180312823 22:11253340-11253362 CCCCAAACCTTCCGGGTGCCCAC No data
Right 1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG No data
1180312828_1180312843 16 Left 1180312828 22:11253351-11253373 CCGGGTGCCCACCAGGCCCACTC No data
Right 1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG No data
1180312824_1180312843 26 Left 1180312824 22:11253341-11253363 CCCAAACCTTCCGGGTGCCCACC No data
Right 1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180312843 Original CRISPR GGTCCCGAAGGCGCACGCCC GGG Intergenic